Rroxscaffold_4G00319460

Testis-expressed sequence 10 protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
47300558 .. 47301861
1304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00319460.1

Sequence Viewer

Length: 378 bp
ATGGCAGGTTCTAAAAATGCCTCAAAGAAGAAGCAAAAGCGCAGTATCGACTTCAAGAAAATAAAGCGAAAGATTGGCAGAAAATTGCCACCAGCACGAATGCTACTAATACCGAGATTAAATCCAAAGAGTGTGGCATCCGAGAAGGCAGGATTAGCAGTGAACAAGAAAGGCTTGACTTTGAAAGAGCTTCTTCAACAAACATCTCATTACAGCTCAAAAGTCCGTAAAGACGCATTGTTGGGAATTAAGGATTTATTCTTTAAGCATCCAGAAGAGTTGAGGTTGCATAAGTACGCTGTTATTGAAAAACTGCGTGAACGCATTGGTGATGATGATAGACTAGTTCGAGAAACGCTGTATCAACTTTTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

14.48

Weight (kDa)

10.47

Isoelectric Point (pI)

40.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 296
AgsI TTSAA 5 cut(s) 55, 184, 197, 308, 373
AhlI ACTAGT 1 cut(s) 343
AluBI AGCT 2 cut(s) 190, 216
AluI AGCT 2 cut(s) 190, 216
AspLEI GCGC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 341
BcuI ACTAGT 1 cut(s) 343
BfaI CTAG 1 cut(s) 344
BmsI GCATC 2 cut(s) 146, 277
BseGI GGATG 2 cut(s) 137, 268
BsmI GAATGC 1 cut(s) 105
Bst6I CTCTTC 1 cut(s) 270
BstF5I GGATG 2 cut(s) 137, 268
BstHHI GCGC 1 cut(s) 42
BstMWI GCNNNNNNNGC 1 cut(s) 155
BtsCI GGATG 2 cut(s) 137, 268
BtsI GCAGTG 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 165
CfoI GCGC 1 cut(s) 42
CseI GACGC 1 cut(s) 242
Csp6I GTAC 1 cut(s) 295
CspCI CAANNNNNGTGG 2 cut(s) 114, 149
CviJI RGCY 3 cut(s) 174, 190, 216
CviKI_1 RGCY 3 cut(s) 174, 190, 216
CviQI GTAC 1 cut(s) 295
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
FaiI YATR 1 cut(s) 291
FalI AAGNNNNNCTT 4 cut(s) 158, 190, 177, 209
FokI GGATG 2 cut(s) 124, 255
FspBI CTAG 1 cut(s) 344
GlaI GCGC 1 cut(s) 41
HgaI GACGC 1 cut(s) 242
HhaI GCGC 1 cut(s) 42
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HphI GGTGA 1 cut(s) 341
Hpy166II GTNNAC 2 cut(s) 163, 320
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 3 cut(s) 55, 272, 350
Hpy8I GTNNAC 2 cut(s) 163, 320
HpyAV CCTTC 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HspAI GCGC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 105, 135, 285
LweI GCATC 2 cut(s) 146, 277
MaeI CTAG 1 cut(s) 344
MboII GAAGA 3 cut(s) 40, 185, 287
MluCI AATT 2 cut(s) 83, 246
MnlI CCTC 2 cut(s) 31, 276
MseI TTAA 3 cut(s) 119, 249, 264
Mva1269I GAATGC 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 155
PctI GAATGC 1 cut(s) 105
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SaqAI TTAA 3 cut(s) 119, 249, 264
SetI ASST 4 cut(s) 10, 192, 218, 287
SfaNI GCATC 2 cut(s) 146, 277
SpeI ACTAGT 1 cut(s) 343
Sse9I AATT 2 cut(s) 83, 246
SspMI CTAG 1 cut(s) 344
TaqI TCGA 2 cut(s) 48, 349
TasI AATT 2 cut(s) 83, 246
Tru1I TTAA 3 cut(s) 119, 249, 264
Tru9I TTAA 3 cut(s) 119, 249, 264
TscAI CASTG 1 cut(s) 165
TspGWI ACGGA 1 cut(s) 215
TspRI CASTG 1 cut(s) 165
XspI CTAG 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.