Rh1CG110600

Vacuolar sorting 38 and autophagy-related subunit 14

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
22282185 .. 22286947
4763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG110600.1

Sequence Viewer

Length: 339 bp
ATGGCAGGCTCTAAAAATGCGTCAAAGAAGAAGCAAAAGCGCGGTATCGACTTCAAGAAAATAAAGCGAAAGATTGGCAGAAAATTGCCACCGGCACAGAATGCTACAAATACTGAAATTAAATCTAAAGCTTCGATCTCCAAGCTCGTCGATCCGGCTCAGAGGCTTCTTACCTACATCGCCGACCACTCTGAGGCTACTCTTGTTAAGGGTAAGGCAGATGATCAACTAAATTGGAGATTGATTCAAAATGAGAAGCTCGTGAGGTTGAGGGAAAAGCTCCGGCGTAGTAAAGAACAACTTGTGCAAGGGAAGGCTAAGACTGAGAAGACATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.72

Weight (kDa)

10.61

Isoelectric Point (pI)

28.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 42
AciI CCGC 1 cut(s) 42
AclWI GGATC 1 cut(s) 146
AfiI CCNNNNNNNGG 1 cut(s) 193
AgsI TTSAA 2 cut(s) 55, 248
AluBI AGCT 4 cut(s) 131, 145, 259, 280
AluI AGCT 4 cut(s) 131, 145, 259, 280
AlwI GGATC 1 cut(s) 146
AspLEI GCGC 1 cut(s) 42
BauI CACGAG 1 cut(s) 260
BbsI GAAGAC 1 cut(s) 335
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 337
BpiI GAAGAC 1 cut(s) 335
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse118I RCCGGY 1 cut(s) 91
BseGI GGATG 1 cut(s) 332
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMII CTCAG 3 cut(s) 173, 183, 315
Bsh1236I CGCG 1 cut(s) 42
BsiSI CCGG 3 cut(s) 92, 155, 283
BslI CCNNNNNNNGG 1 cut(s) 193
BsmI GAATGC 1 cut(s) 106
Bsp143I GATC 3 cut(s) 135, 151, 223
BspACI CCGC 1 cut(s) 42
BspCNI CTCAG 3 cut(s) 172, 184, 316
BspFNI CGCG 1 cut(s) 42
BspPI GGATC 1 cut(s) 146
BsrFI RCCGGY 1 cut(s) 91
BssAI RCCGGY 1 cut(s) 91
BssMI GATC 3 cut(s) 135, 151, 223
BssSI CACGAG 1 cut(s) 260
Bst2BI CACGAG 1 cut(s) 260
BstAPI GCANNNNNTGC 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 4 cut(s) 159, 192, 318, 324
BstF5I GGATG 1 cut(s) 332
BstFNI CGCG 1 cut(s) 42
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 3 cut(s) 138, 154, 226
BstMBI GATC 3 cut(s) 135, 151, 223
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstUI CGCG 1 cut(s) 42
BstV2I GAAGAC 1 cut(s) 335
BtgZI GCGATG 1 cut(s) 163
BtsCI GGATG 1 cut(s) 332
Cac8I GCNNGC 1 cut(s) 7
CfoI GCGC 1 cut(s) 42
Cfr10I RCCGGY 1 cut(s) 91
CseI GACGC 1 cut(s) 9
CviJI RGCY 9 cut(s) 9, 131, 145, 158, 166, 197, 259, 280, 317
CviKI_1 RGCY 9 cut(s) 9, 131, 145, 158, 166, 197, 259, 280, 317
DdeI CTNAG 4 cut(s) 159, 192, 318, 324
DpnI GATC 3 cut(s) 137, 153, 225
DpnII GATC 3 cut(s) 135, 151, 223
FalI AAGNNNNNCTT 2 cut(s) 285, 317
FbaI TGATCA 1 cut(s) 223
FokI GGATG 1 cut(s) 319
FspBI CTAG 1 cut(s) 337
GlaI GCGC 1 cut(s) 41
HapII CCGG 3 cut(s) 92, 155, 283
HgaI GACGC 1 cut(s) 9
HhaI GCGC 1 cut(s) 42
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HindIII AAGCTT 1 cut(s) 129
HinfI GANTC 1 cut(s) 244
HpaII CCGG 3 cut(s) 92, 155, 283
Hpy188I TCNGA 2 cut(s) 162, 193
Hpy188III TCNNGA 2 cut(s) 55, 262
Hpy99I CGWCG 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 307
HpyCH4V TGCA 1 cut(s) 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 4 cut(s) 159, 192, 318, 324
HspAI GCGC 1 cut(s) 40
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 3 cut(s) 135, 151, 223
LmnI GCTCC 1 cut(s) 285
LpnPI CCDG 3 cut(s) 105, 168, 296
MaeI CTAG 1 cut(s) 337
MalI GATC 3 cut(s) 137, 153, 225
MboI GATC 3 cut(s) 135, 151, 223
MboII GAAGA 1 cut(s) 40
MluCI AATT 3 cut(s) 83, 117, 232
MnlI CCTC 4 cut(s) 156, 187, 258, 264
MseI TTAA 2 cut(s) 120, 207
MspI CCGG 3 cut(s) 92, 155, 283
Mva1269I GAATGC 1 cut(s) 106
MvnI CGCG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 3 cut(s) 135, 151, 223
PctI GAATGC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 244
SaqAI TTAA 2 cut(s) 120, 207
Sau3AI GATC 3 cut(s) 135, 151, 223
SetI ASST 6 cut(s) 133, 147, 176, 261, 269, 282
Sse9I AATT 3 cut(s) 83, 117, 232
SsiI CCGC 1 cut(s) 42
SspMI CTAG 1 cut(s) 337
TaqI TCGA 3 cut(s) 48, 134, 150
TasI AATT 3 cut(s) 83, 117, 232
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 2 cut(s) 120, 207
Tru9I TTAA 2 cut(s) 120, 207
XspI CTAG 1 cut(s) 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.