Rroxscaffold_7G00183620

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
22709563 .. 22709883
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00183620.1

Sequence Viewer

Length: 321 bp
ATGCAGTCGCGAAGCGAAGACGAGGAGGACAAAGAGGAGGAATACAATGATGAAGAAGAAGAAGACGAAGAAGAAGAAGGTGAATTAGAATCATCCGTGGTGGATCGCAAGGGGAAGGGGATTATGAGAGATGATAAGGGCAAAAAGATACCGATAGAAAATGAAGATGACAAGGAGGATAGCGACGACGGTGGAAGCGAATTCGAAGACGGCGACAACGATTTGTTCAATGATCCTTTTGCGGAGATCGATTTGGACAACATTCTTCCTTCCAAGACTCGAAGACGACAAGTTCAACCTAATGTAAACCGAATCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.3

Weight (kDa)

4.05

Isoelectric Point (pI)

86.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 10
AciI CCGC 1 cut(s) 242
AclWI GGATC 2 cut(s) 111, 227
AcsI RAATTY 1 cut(s) 200
AgsI TTSAA 2 cut(s) 229, 296
AlwI GGATC 2 cut(s) 111, 227
ApoI RAATTY 1 cut(s) 200
AsuHPI GGTGA 1 cut(s) 92
AsuII TTCGAA 1 cut(s) 204
BbsI GAAGAC 4 cut(s) 24, 69, 213, 289
BceAI ACGGC 1 cut(s) 226
BpiI GAAGAC 4 cut(s) 24, 69, 213, 289
Bpu14I TTCGAA 1 cut(s) 204
Bsa29I ATCGAT 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 96
BseCI ATCGAT 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 96
BseGI GGATG 1 cut(s) 92
BseRI GAGGAG 2 cut(s) 38, 50
Bsh1236I CGCG 1 cut(s) 10
BshVI ATCGAT 1 cut(s) 249
Bsp119I TTCGAA 1 cut(s) 204
Bsp143I GATC 3 cut(s) 103, 232, 246
Bsp68I TCGCGA 1 cut(s) 10
BspACI CCGC 1 cut(s) 242
BspDI ATCGAT 1 cut(s) 249
BspFNI CGCG 1 cut(s) 10
BspPI GGATC 2 cut(s) 111, 227
BspT104I TTCGAA 1 cut(s) 204
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 3 cut(s) 103, 232, 246
Bst4CI ACNGT 1 cut(s) 191
BstBI TTCGAA 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 92
BstFNI CGCG 1 cut(s) 10
BstKTI GATC 3 cut(s) 106, 235, 249
BstMBI GATC 3 cut(s) 103, 232, 246
BstUI CGCG 1 cut(s) 10
BstV2I GAAGAC 4 cut(s) 24, 69, 213, 289
Bsu15I ATCGAT 1 cut(s) 249
BsuTUI ATCGAT 1 cut(s) 249
BtgI CCRYGG 1 cut(s) 96
BtsCI GGATG 1 cut(s) 92
BtuMI TCGCGA 1 cut(s) 10
ClaI ATCGAT 1 cut(s) 249
DpnI GATC 3 cut(s) 105, 234, 248
DpnII GATC 3 cut(s) 103, 232, 246
EcoRI GAATTC 1 cut(s) 200
FaiI YATR 1 cut(s) 125
FokI GGATG 1 cut(s) 79
HinfI GANTC 3 cut(s) 89, 277, 312
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 307
Hpy188III TCNNGA 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 307
Hpy99I CGWCG 2 cut(s) 188, 191
HpyAV CCTTC 3 cut(s) 71, 109, 279
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 3 cut(s) 103, 232, 246
MalI GATC 3 cut(s) 105, 234, 248
MboI GATC 3 cut(s) 103, 232, 246
MluCI AATT 2 cut(s) 83, 200
MlyI GAGTC 1 cut(s) 271
MnlI CCTC 5 cut(s) 16, 19, 28, 31, 169
MseI TTAA 1 cut(s) 319
MvnI CGCG 1 cut(s) 10
NdeII GATC 3 cut(s) 103, 232, 246
NruI TCGCGA 1 cut(s) 10
NspV TTCGAA 1 cut(s) 204
PcsI WCGNNNNNNNCGW 3 cut(s) 195, 210, 216
PfeI GAWTC 2 cut(s) 89, 312
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
RruI TCGCGA 1 cut(s) 10
SaqAI TTAA 1 cut(s) 319
Sau3AI GATC 3 cut(s) 103, 232, 246
SchI GAGTC 1 cut(s) 271
SetI ASST 2 cut(s) 82, 301
SfuI TTCGAA 1 cut(s) 204
SgeI CNNG 8 cut(s) 21, 34, 109, 121, 184, 286, 291, 302
Sse9I AATT 2 cut(s) 83, 200
SsiI CCGC 1 cut(s) 242
TaaI ACNGT 1 cut(s) 191
TaqI TCGA 3 cut(s) 204, 249, 280
TasI AATT 2 cut(s) 83, 200
TfiI GAWTC 2 cut(s) 89, 312
Tru1I TTAA 1 cut(s) 319
Tru9I TTAA 1 cut(s) 319
TspDTI ATGAA 2 cut(s) 66, 177
TspGWI ACGGA 1 cut(s) 85
XapI RAATTY 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.