Rh6DG278400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
47251540 .. 47251795
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG278400.1

Sequence Viewer

Length: 189 bp
ATGAGAGATGATAAGGGCAAAGAGATATTGATAGAAGATGAAGATGGCGAGGAGGATAGCAACGACGGTGGAAGCGAATTCGAAGACGACGACAACAATTTGTTCGACGATCCTCTTGCGGAGATCTATTTGGACAACATTCTTCCTTCCAAGACTCGAAGACGACAGGTTCAACCTGATGTAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.14

Weight (kDa)

4.05

Isoelectric Point (pI)

86.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 119
AclWI GGATC 1 cut(s) 104
AcsI RAATTY 1 cut(s) 77
AgsI TTSAA 1 cut(s) 173
AlwI GGATC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 77
AsuII TTCGAA 1 cut(s) 81
BbsI GAAGAC 2 cut(s) 90, 166
BccI CCATC 1 cut(s) 38
BcgI CGANNNNNNTGC 2 cut(s) 98, 132
BglII AGATCT 1 cut(s) 123
BpiI GAAGAC 2 cut(s) 90, 166
Bpu14I TTCGAA 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 65
Bsp119I TTCGAA 1 cut(s) 81
Bsp143I GATC 2 cut(s) 109, 123
BspACI CCGC 1 cut(s) 119
BspPI GGATC 1 cut(s) 104
BspT104I TTCGAA 1 cut(s) 81
BssMI GATC 2 cut(s) 109, 123
Bst4CI ACNGT 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 81
BstKTI GATC 2 cut(s) 112, 126
BstMBI GATC 2 cut(s) 109, 123
BstV2I GAAGAC 2 cut(s) 90, 166
BstX2I RGATCY 1 cut(s) 123
BstYI RGATCY 1 cut(s) 123
CspCI CAANNNNNGTGG 2 cut(s) 49, 84
DpnI GATC 2 cut(s) 111, 125
DpnII GATC 2 cut(s) 109, 123
EcoRI GAATTC 1 cut(s) 77
HinfI GANTC 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 184
Hpy8I GTNNAC 1 cut(s) 184
Hpy99I CGWCG 3 cut(s) 68, 92, 110
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 68
Kzo9I GATC 2 cut(s) 109, 123
LpnPI CCDG 1 cut(s) 152
MalI GATC 2 cut(s) 111, 125
MboI GATC 2 cut(s) 109, 123
MboII GAAGA 5 cut(s) 47, 53, 95, 134, 171
MflI RGATCY 1 cut(s) 123
MluCI AATT 2 cut(s) 77, 97
MlyI GAGTC 1 cut(s) 148
MnlI CCTC 3 cut(s) 43, 46, 123
NdeII GATC 2 cut(s) 109, 123
NspV TTCGAA 1 cut(s) 81
PcsI WCGNNNNNNNCGW 2 cut(s) 72, 87
PleI GAGTC 1 cut(s) 148
PpsI GAGTC 1 cut(s) 148
PsuI RGATCY 1 cut(s) 123
Sau3AI GATC 2 cut(s) 109, 123
SchI GAGTC 1 cut(s) 148
SetI ASST 2 cut(s) 171, 178
SfuI TTCGAA 1 cut(s) 81
SgeI CNNG 5 cut(s) 61, 128, 163, 168, 179
Sse9I AATT 2 cut(s) 77, 97
SsiI CCGC 1 cut(s) 119
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 3 cut(s) 81, 105, 157
TasI AATT 2 cut(s) 77, 97
TspDTI ATGAA 1 cut(s) 54
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.