Rh1CG085100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
17769821 .. 17770069
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG085100.1

Sequence Viewer

Length: 249 bp
ATGAGAGATGATAAGGGCAAAGGGATACTGATAGAAGATGAAGATGACAAGGAGGATAGCGACAATGACTCCTCCAGCGACGACGCTGGAAGCGAATTTGAAGATAGTGACAGCGATTTGTCTGACGATCCTCTTGCGAAGGTCGATTTGGACAACATTCTTCTTTCCAAGACTAGGAGACGGCAGGTTCAACCTGGGGTTTACATCCACAATGATAACAATGCAAACAACAATGAAGGACAAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.13

Weight (kDa)

4.05

Isoelectric Point (pI)

62.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 175
AclWI GGATC 1 cut(s) 122
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 174
AgsI TTSAA 2 cut(s) 101, 191
AjnI CCWGG 1 cut(s) 193
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
Alw26I GTCTC 1 cut(s) 172
AlwI GGATC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 95
BceAI ACGGC 1 cut(s) 197
BcgI CGANNNNNNTGC 2 cut(s) 116, 150
BciT130I CCWGG 1 cut(s) 195
BciVI GTATCC 1 cut(s) 18
BcoDI GTCTC 1 cut(s) 172
BfaI CTAG 1 cut(s) 174
BfuAI ACCTGC 1 cut(s) 175
BfuI GTATCC 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BpmI CTGGAG 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 194
BsaXI ACNNNNNCTCC 2 cut(s) 53, 83
Bsc4I CCNNNNNNNGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 174
BsmAI GTCTC 1 cut(s) 172
BsmBI CGTCTC 1 cut(s) 172
Bsp143I GATC 1 cut(s) 127
BspMI ACCTGC 1 cut(s) 175
BspPI GGATC 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 204
BstKTI GATC 1 cut(s) 130
BstMAI GTCTC 1 cut(s) 172
BstMBI GATC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BsuI GTATCC 1 cut(s) 18
BtsCI GGATG 1 cut(s) 204
BveI ACCTGC 1 cut(s) 175
CseI GACGC 1 cut(s) 92
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 193
Esp3I CGTCTC 1 cut(s) 172
FaiI YATR 1 cut(s) 247
FokI GGATG 1 cut(s) 191
FspBI CTAG 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 58
HgaI GACGC 1 cut(s) 92
HinfI GANTC 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 202
Hpy99I CGWCG 2 cut(s) 83, 86
HpyAV CCTTC 2 cut(s) 133, 230
HpyCH4V TGCA 1 cut(s) 224
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 5 cut(s) 72, 88, 170, 180, 207
MaeI CTAG 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 107
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 4 cut(s) 47, 53, 113, 152
MluCI AATT 1 cut(s) 95
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 3 cut(s) 46, 82, 141
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeII GATC 1 cut(s) 127
NmuCI GTSAC 1 cut(s) 107
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 195
SetI ASST 3 cut(s) 144, 189, 196
SgeI CNNG 9 cut(s) 61, 87, 99, 146, 181, 186, 197, 206, 207
Sse9I AATT 1 cut(s) 95
SspMI CTAG 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 193
TaqI TCGA 1 cut(s) 144
TasI AATT 1 cut(s) 95
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 54, 249
XapI RAATTY 1 cut(s) 95
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.