Rh6AG282600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
47855565 .. 47855723
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG282600.1

Sequence Viewer

Length: 159 bp
ATGAGAGATGATAAGGGCAAAGAGATATTGATAGAAAATGAAGATGACGAGGAGGATAGCGACGACGGTGGAAGCGAATTTGAAGACGACGACAAAAATTTGTTCGACGATCCTCTTGCGGAGATCGATTTGGACAACATTCTTCCTTCCAAGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.92

Weight (kDa)

4.05

Isoelectric Point (pI)

70.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 119
AclWI GGATC 1 cut(s) 104
AcsI RAATTY 2 cut(s) 77, 97
AgsI TTSAA 1 cut(s) 83
AlwI GGATC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 77, 97
BbsI GAAGAC 1 cut(s) 90
BcgI CGANNNNNNTGC 2 cut(s) 98, 132
BpiI GAAGAC 1 cut(s) 90
Bsa29I ATCGAT 1 cut(s) 126
BseCI ATCGAT 1 cut(s) 126
BseRI GAGGAG 1 cut(s) 65
BshVI ATCGAT 1 cut(s) 126
Bsp143I GATC 2 cut(s) 109, 123
BspACI CCGC 1 cut(s) 119
BspDI ATCGAT 1 cut(s) 126
BspPI GGATC 1 cut(s) 104
BssMI GATC 2 cut(s) 109, 123
Bst4CI ACNGT 1 cut(s) 68
BstKTI GATC 2 cut(s) 112, 126
BstMBI GATC 2 cut(s) 109, 123
BstV2I GAAGAC 1 cut(s) 90
Bsu15I ATCGAT 1 cut(s) 126
BsuTUI ATCGAT 1 cut(s) 126
ClaI ATCGAT 1 cut(s) 126
DpnI GATC 2 cut(s) 111, 125
DpnII GATC 2 cut(s) 109, 123
FspEI CC 7 cut(s) 35, 38, 51, 54, 104, 116, 126
Hpy99I CGWCG 4 cut(s) 65, 68, 92, 110
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 68
Kzo9I GATC 2 cut(s) 109, 123
MalI GATC 2 cut(s) 111, 125
MboI GATC 2 cut(s) 109, 123
MboII GAAGA 3 cut(s) 53, 95, 134
MluCI AATT 2 cut(s) 77, 97
MnlI CCTC 3 cut(s) 43, 46, 123
NdeII GATC 2 cut(s) 109, 123
PcsI WCGNNNNNNNCGW 1 cut(s) 72
Sau3AI GATC 2 cut(s) 109, 123
SgeI CNNG 2 cut(s) 61, 128
Sse9I AATT 2 cut(s) 77, 97
SsiI CCGC 1 cut(s) 119
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 2 cut(s) 105, 126
TasI AATT 2 cut(s) 77, 97
TspDTI ATGAA 1 cut(s) 54
XapI RAATTY 2 cut(s) 77, 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.