Rroxscaffold_7G00188380

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
27959764 .. 27961379
1616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00188380.1

Sequence Viewer

Length: 186 bp
ATGGAAGGATTGAAATTGCAGGGATCGGATTATGAACAAGGCGAGGTCCTACGGTTCAGCCGTAAGGCCACCAAGGACATCTCCTTCGTCGACGATGACATCAAGGGAATTTATGATGATATGAACTTGGGATTTTACCTTGTTGCATATGATGACATTGGGGGCATGTCCTACCAAAAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.92

Weight (kDa)

4.32

Isoelectric Point (pI)

35.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 90
AclWI GGATC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 108
AgsI TTSAA 1 cut(s) 13
AlwI GGATC 1 cut(s) 31
AoxI GGCC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 108
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BceAI ACGGC 1 cut(s) 45
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 72
BshFI GGCC 1 cut(s) 68
BsnI GGCC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 23
BspANI GGCC 1 cut(s) 68
BspPI GGATC 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 1 cut(s) 23
BssT1I CCWWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 54
BstKTI GATC 1 cut(s) 26
BstMBI GATC 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 169
BsuRI GGCC 1 cut(s) 68
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 1 cut(s) 166
CviJI RGCY 3 cut(s) 60, 68, 182
CviKI_1 RGCY 3 cut(s) 60, 68, 182
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eco130I CCWWGG 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 46
EcoO109I RGGNCCY 1 cut(s) 46
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 1 cut(s) 169
FaiI YATR 6 cut(s) 33, 114, 122, 148, 150, 167
FatI CATG 1 cut(s) 165
FauNDI CATATG 1 cut(s) 148
FblI GTMKAC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 68
Hin1II CATG 1 cut(s) 169
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 91
Hpy99I CGWCG 2 cut(s) 92, 95
HpyAV CCTTC 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 54
HpyCH4V TGCA 2 cut(s) 19, 146
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 1 cut(s) 23
LpnPI CCDG 1 cut(s) 5
MalI GATC 1 cut(s) 25
MboI GATC 1 cut(s) 23
MluCI AATT 2 cut(s) 14, 108
MnlI CCTC 1 cut(s) 37
NdeI CATATG 1 cut(s) 148
NdeII GATC 1 cut(s) 23
NlaIII CATG 1 cut(s) 169
NspI RCATGY 1 cut(s) 169
PcsI WCGNNNNNNNCGW 1 cut(s) 58
PpuMI RGGWCCY 1 cut(s) 46
Psp5II RGGWCCY 1 cut(s) 46
PspPI GGNCC 1 cut(s) 46
PspPPI RGGWCCY 1 cut(s) 46
SalI GTCGAC 1 cut(s) 89
Sau3AI GATC 1 cut(s) 23
Sau96I GGNCC 1 cut(s) 46
SetI ASST 2 cut(s) 48, 141
SgeI CNNG 8 cut(s) 32, 50, 55, 85, 115, 139, 152, 178
SgrDI CGTCGACG 1 cut(s) 89
SinI GGWCC 1 cut(s) 46
Sse9I AATT 2 cut(s) 14, 108
StyI CCWWGG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 54
TaqI TCGA 1 cut(s) 90
TasI AATT 2 cut(s) 14, 108
TspDTI ATGAA 2 cut(s) 48, 137
VpaK11BI GGWCC 1 cut(s) 46
XapI RAATTY 1 cut(s) 108
XceI RCATGY 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.