Rh4CG306100

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
56757010 .. 56758901
1892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG306100.1

Sequence Viewer

Length: 360 bp
ATGAACAAGGCGAGGTCCTACTGGTTCAGCCAGAAGGCCACCAAGGAGATCTCCTCCGTCGACGATGACATCAAGGGAATTTATGATGATATGAACTTGGGATTTTACCTTGTTGCATATGATGACATTGGGGGCATTTCCTACCAAAAGGCTTGCGACTTGTCTAGTCACATTTGCAGTTTCACTCGGGTTATCAGTAAGCACCCAATCTTTTGGTCTACAGGCCCTACTTTTTCCGAGTCTCCGTTTGTCCCAAAGGAAGAAAGTTTATATAATAGTCGCATACATATTCGACAAAATGCCGTAGCAGATCACATTCACCAGCTCACAAGAATTGAAGTGGTCTCTCGGATTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

13.65

Weight (kDa)

6.49

Isoelectric Point (pI)

67.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 60, 218
AcsI RAATTY 1 cut(s) 78
AgsI TTSAA 1 cut(s) 338
AluBI AGCT 1 cut(s) 325
AluI AGCT 1 cut(s) 325
Alw26I GTCTC 2 cut(s) 246, 349
Ama87I CYCGRG 1 cut(s) 186
AoxI GGCC 2 cut(s) 36, 223
ApoI RAATTY 1 cut(s) 78
AspS9I GGNCC 2 cut(s) 15, 224
AsuHPI GGTGA 1 cut(s) 311
AvaI CYCGRG 1 cut(s) 186
AvaII GGWCC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 287
BcoDI GTCTC 2 cut(s) 246, 349
BfaI CTAG 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 219
BglII AGATCT 1 cut(s) 48
Bme18I GGWCC 1 cut(s) 15
BmeT110I CYCGRG 1 cut(s) 186
BmgT120I GGNCC 2 cut(s) 15, 224
BplI GAGNNNNNCTC 2 cut(s) 38, 70
BsaI GGTCTC 1 cut(s) 349
BsaJI CCNNGG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 26
BseRI GAGGAG 1 cut(s) 43
BshFI GGCC 2 cut(s) 38, 225
BsiHKCI CYCGRG 1 cut(s) 186
BslFI GGGAC 1 cut(s) 236
BsmAI GTCTC 2 cut(s) 246, 349
BsmFI GGGAC 1 cut(s) 236
BsnI GGCC 2 cut(s) 38, 225
Bso31I GGTCTC 1 cut(s) 349
BsoBI CYCGRG 1 cut(s) 186
Bsp143I GATC 2 cut(s) 48, 310
BspANI GGCC 2 cut(s) 38, 225
BspTNI GGTCTC 1 cut(s) 349
BsrI ACTGG 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 42
BssMI GATC 2 cut(s) 48, 310
BssT1I CCWWGG 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 154
BstKTI GATC 2 cut(s) 51, 313
BstMAI GTCTC 2 cut(s) 246, 349
BstMBI GATC 2 cut(s) 48, 310
BstSFI CTRYAG 1 cut(s) 219
BstX2I RGATCY 1 cut(s) 48
BstXI CCANNNNNNTGG 1 cut(s) 213
BstYI RGATCY 1 cut(s) 48
BsuRI GGCC 2 cut(s) 38, 225
Cac8I GCNNGC 1 cut(s) 154
Cfr13I GGNCC 2 cut(s) 15, 224
CviJI RGCY 5 cut(s) 30, 38, 152, 225, 325
CviKI_1 RGCY 5 cut(s) 30, 38, 152, 225, 325
DpnI GATC 2 cut(s) 50, 312
DpnII GATC 2 cut(s) 48, 310
Eco130I CCWWGG 1 cut(s) 42
Eco31I GGTCTC 1 cut(s) 349
Eco47I GGWCC 1 cut(s) 15
Eco88I CYCGRG 1 cut(s) 186
EcoO109I RGGNCCY 2 cut(s) 15, 224
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
FaiI YATR 8 cut(s) 84, 92, 118, 120, 271, 273, 284, 288
FaqI GGGAC 1 cut(s) 236
FauNDI CATATG 1 cut(s) 118
FblI GTMKAC 2 cut(s) 60, 218
FspBI CTAG 1 cut(s) 165
HaeIII GGCC 2 cut(s) 38, 225
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HinfI GANTC 2 cut(s) 239, 352
HphI GGTGA 1 cut(s) 311
Hpy166II GTNNAC 2 cut(s) 61, 219
Hpy188I TCNGA 2 cut(s) 238, 351
Hpy8I GTNNAC 2 cut(s) 61, 219
Hpy99I CGWCG 2 cut(s) 62, 65
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 2 cut(s) 116, 177
Kzo9I GATC 2 cut(s) 48, 310
LpnPI CCDG 4 cut(s) 7, 44, 207, 335
MaeI CTAG 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 167
MalI GATC 2 cut(s) 50, 312
MboI GATC 2 cut(s) 48, 310
MboII GAAGA 1 cut(s) 272
MflI RGATCY 1 cut(s) 48
MluCI AATT 2 cut(s) 78, 333
MlyI GAGTC 1 cut(s) 248
MnlI CCTC 2 cut(s) 6, 64
NdeI CATATG 1 cut(s) 118
NdeII GATC 2 cut(s) 48, 310
NmuCI GTSAC 1 cut(s) 167
PfeI GAWTC 1 cut(s) 352
PleI GAGTC 1 cut(s) 247
PpsI GAGTC 1 cut(s) 247
PpuMI RGGWCCY 1 cut(s) 15
Psp5II RGGWCCY 1 cut(s) 15
PspPI GGNCC 2 cut(s) 15, 224
PspPPI RGGWCCY 1 cut(s) 15
PsuI RGATCY 1 cut(s) 48
SalI GTCGAC 1 cut(s) 59
Sau3AI GATC 2 cut(s) 48, 310
Sau96I GGNCC 2 cut(s) 15, 224
SchI GAGTC 1 cut(s) 248
SetI ASST 3 cut(s) 17, 111, 327
SfcI CTRYAG 1 cut(s) 219
SgrDI CGTCGACG 1 cut(s) 59
SinI GGWCC 1 cut(s) 15
Sse9I AATT 2 cut(s) 78, 333
SspMI CTAG 1 cut(s) 165
StyI CCWWGG 1 cut(s) 42
TaqI TCGA 2 cut(s) 60, 292
TasI AATT 2 cut(s) 78, 333
TfiI GAWTC 1 cut(s) 352
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 2 cut(s) 17, 107
TspGWI ACGGA 2 cut(s) 46, 234
VpaK11BI GGWCC 1 cut(s) 15
XapI RAATTY 1 cut(s) 78
XmiI GTMKAC 2 cut(s) 60, 218
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.