Rorug02G0576800

Ankyrin repeats (many copies)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
70118417 .. 70119775
1359 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0576800.1

Sequence Viewer

Length: 240 bp
ATGACTCTTTGCAAATGCTTTCCTACAAATCTTTATATGTCGTTGACTGGAAGGACATTTAAAGCAACAACTGATAGCTTTTCTGATCTCAGCAACAATGTCACCAATTACCACTTGATTCGCGGCGCATCTGATCTCAGGGTCACTCATGCTGACCAGTCAACTTCGATGCAAATGTTGTTGGATTTGACCAAGACAAGGATGTTGCGGTTTTACATGTTGCATCCAAAGACATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.15

Weight (kDa)

9.39

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 123
AciI CCGC 2 cut(s) 123, 208
AfiI CCNNNNNNNGG 1 cut(s) 198
AflIII ACRYGT 1 cut(s) 216
AluBI AGCT 1 cut(s) 78
AluI AGCT 1 cut(s) 78
AspLEI GCGC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 94
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
BmsI GCATC 3 cut(s) 137, 159, 232
Bsc4I CCNNNNNNNGG 1 cut(s) 198
Bse1I ACTGG 2 cut(s) 52, 157
BseGI GGATG 2 cut(s) 207, 223
BseLI CCNNNNNNNGG 1 cut(s) 198
BseMII CTCAG 2 cut(s) 103, 151
BseNI ACTGG 2 cut(s) 52, 157
Bsh1236I CGCG 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 198
Bsp143I GATC 2 cut(s) 85, 133
BspACI CCGC 2 cut(s) 123, 208
BspCNI CTCAG 2 cut(s) 102, 150
BspFNI CGCG 1 cut(s) 123
BsrI ACTGG 2 cut(s) 52, 157
BssMI GATC 2 cut(s) 85, 133
BstDEI CTNAG 2 cut(s) 89, 137
BstF5I GGATG 2 cut(s) 207, 223
BstFNI CGCG 1 cut(s) 123
BstHHI GCGC 1 cut(s) 128
BstKTI GATC 2 cut(s) 88, 136
BstMBI GATC 2 cut(s) 85, 133
BstNSI RCATGY 1 cut(s) 220
BstUI CGCG 1 cut(s) 123
BtsCI GGATG 2 cut(s) 207, 223
CfoI GCGC 1 cut(s) 128
CviAII CATG 2 cut(s) 149, 217
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
DdeI CTNAG 2 cut(s) 89, 137
DpnI GATC 2 cut(s) 87, 135
DpnII GATC 2 cut(s) 85, 133
DraI TTTAAA 1 cut(s) 61
FaeI CATG 2 cut(s) 152, 220
FaiI YATR 5 cut(s) 36, 38, 150, 218, 235
FatI CATG 2 cut(s) 148, 216
Fnu4HI GCNGC 1 cut(s) 124
FokI GGATG 2 cut(s) 210, 214
Fsp4HI GCNGC 1 cut(s) 124
GlaI GCGC 1 cut(s) 127
GluI GCNGC 1 cut(s) 124
HhaI GCGC 1 cut(s) 128
Hin1II CATG 2 cut(s) 152, 220
Hin6I GCGC 1 cut(s) 126
HinP1I GCGC 1 cut(s) 126
HincII GTYRAC 2 cut(s) 45, 162
HindII GTYRAC 2 cut(s) 45, 162
HinfI GANTC 2 cut(s) 4, 118
HphI GGTGA 1 cut(s) 94
Hpy166II GTNNAC 2 cut(s) 45, 162
Hpy188I TCNGA 2 cut(s) 85, 133
Hpy8I GTNNAC 2 cut(s) 45, 162
HpyAV CCTTC 1 cut(s) 45
HpyCH4V TGCA 3 cut(s) 12, 172, 223
HpyF3I CTNAG 2 cut(s) 89, 137
Hsp92II CATG 2 cut(s) 152, 220
HspAI GCGC 1 cut(s) 126
Kzo9I GATC 2 cut(s) 85, 133
LpnPI CCDG 3 cut(s) 33, 124, 170
LweI GCATC 3 cut(s) 137, 159, 232
MaeIII GTNAC 2 cut(s) 100, 142
MalI GATC 2 cut(s) 87, 135
MboI GATC 2 cut(s) 85, 133
MluCI AATT 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 162
MseI TTAA 1 cut(s) 60
MvnI CGCG 1 cut(s) 123
NdeII GATC 2 cut(s) 85, 133
NlaIII CATG 2 cut(s) 152, 220
NmuCI GTSAC 2 cut(s) 100, 142
NspI RCATGY 1 cut(s) 220
PciI ACATGT 1 cut(s) 216
PfeI GAWTC 1 cut(s) 118
PkrI GCNGC 1 cut(s) 125
PscI ACATGT 1 cut(s) 216
SaqAI TTAA 1 cut(s) 60
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 2 cut(s) 85, 133
SetI ASST 1 cut(s) 80
SfaNI GCATC 3 cut(s) 137, 159, 232
SgeI CNNG 9 cut(s) 60, 127, 134, 151, 161, 169, 205, 210, 229
Sse9I AATT 1 cut(s) 106
SsiI CCGC 2 cut(s) 123, 208
TaqI TCGA 1 cut(s) 167
TasI AATT 1 cut(s) 106
TauI GCSGC 1 cut(s) 126
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TseFI GTSAC 2 cut(s) 100, 142
Tsp45I GTSAC 2 cut(s) 100, 142
XceI RCATGY 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.