Rorug04G0249700

Ankyrin repeats (3 copies)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
42195643 .. 42195807
165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0249700.1

Sequence Viewer

Length: 165 bp
ATGCATTGCATTGACCACGGCTTCCCTCTATGTATTGAAGCAAAGAAGGGAGTGAAGAAGCTGGTGGACTTGAATACTGATTTCTTGAAGAACATATATCCTAAGATCGAGTTGGAAGGCCCTCGTCTTTGCTTCTTGTATAATGGGTTTTGCGGAGCTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.11

Weight (kDa)

7.67

Isoelectric Point (pI)

34.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 153
AgsI TTSAA 3 cut(s) 38, 73, 88
AluBI AGCT 2 cut(s) 61, 158
AluI AGCT 2 cut(s) 61, 158
Alw21I GWGCWC 1 cut(s) 160
AoxI GGCC 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 119
BanII GRGCYC 1 cut(s) 160
Bbv12I GWGCWC 1 cut(s) 160
BceAI ACGGC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 16
Bse3DI GCAATG 1 cut(s) 4
BseDI CCNNGG 1 cut(s) 16
BseMI GCAATG 1 cut(s) 4
BshFI GGCC 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 160
BsnI GGCC 1 cut(s) 120
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 1 cut(s) 105
BspACI CCGC 1 cut(s) 153
BspANI GGCC 1 cut(s) 120
BsrDI GCAATG 1 cut(s) 4
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 16
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 120
BtgI CCRYGG 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 119
CviJI RGCY 4 cut(s) 21, 61, 120, 158
CviKI_1 RGCY 4 cut(s) 21, 61, 120, 158
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Ecl136II GAGCTC 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 160
Eco53kI GAGCTC 1 cut(s) 158
EcoICRI GAGCTC 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 119
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 160
FaiI YATR 4 cut(s) 31, 95, 97, 141
FriOI GRGCYC 1 cut(s) 160
HaeIII GGCC 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 85
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 40, 110
HpyCH4V TGCA 2 cut(s) 4, 9
HpyF3I CTNAG 1 cut(s) 102
Kzo9I GATC 1 cut(s) 105
LmnI GCTCC 2 cut(s) 155, 163
LpnPI CCDG 1 cut(s) 47
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 2 cut(s) 67, 100
MhlI GDGCHC 1 cut(s) 160
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 2 cut(s) 36, 132
Mph1103I ATGCAT 1 cut(s) 6
NdeII GATC 1 cut(s) 105
NsiI ATGCAT 1 cut(s) 6
Psp124BI GAGCTC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 119
SacI GAGCTC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 119
SduI GDGCHC 1 cut(s) 160
SetI ASST 2 cut(s) 63, 160
SgeI CNNG 7 cut(s) 29, 74, 82, 97, 121, 135, 148
SsiI CCGC 1 cut(s) 153
SstI GAGCTC 1 cut(s) 160
TaqI TCGA 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.