Rorug02G0629900

E3 ubiquitin protein ligase DRIP2-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
74446684 .. 74449014
2331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0629900.1

Sequence Viewer

Length: 312 bp
ATGTCTAAGATCTCACACCAATCAGTGGCTACGCCTACTAGCTTGGCCTCGGTGTCCACTATTCCGGCTTGCAAGATATCAGAGGTTGTGAACAACATGAAAGATTTGATCGAATTCTGCCAGGAAAACAAAGTTGGCCCAATTGAGGGCTTGCAGGTTCATCCTCGACATGCGAATGCAACCAAGCTTCAGATGCAAAGGATGCACGAAATGGAGCAGTTAGCAAGTGTTCAGGGCATGCCAACTGATAGGAACACATTGAATAAGCTAATGGTAATAACAACCATCACATGGCCAGGGGAGGAGCTTTGA

Protein Analysis

103

Amino Acids

11.44

Weight (kDa)

6.4

Isoelectric Point (pI)

53.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 145
AccB7I CCANNNNNTGG 2 cut(s) 25, 291
AcoI YGGCCR 1 cut(s) 293
AcsI RAATTY 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 173
AfiI CCNNNNNNNGG 4 cut(s) 25, 145, 146, 291
AgsI TTSAA 1 cut(s) 262
AjnI CCWGG 2 cut(s) 120, 295
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 4 cut(s) 42, 187, 268, 307
AluI AGCT 4 cut(s) 42, 187, 268, 307
AoxI GGCC 3 cut(s) 45, 136, 293
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 137
BalI TGGCCA 1 cut(s) 295
BccI CCATC 1 cut(s) 293
BciT130I CCWGG 2 cut(s) 122, 297
BfaI CTAG 1 cut(s) 39
BfuAI ACCTGC 1 cut(s) 145
BglII AGATCT 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 122, 297
BmgT120I GGNCC 1 cut(s) 137
BmrFI CCNGG 2 cut(s) 122, 297
BmsI GCATC 2 cut(s) 183, 192
BsaJI CCNNGG 2 cut(s) 48, 296
Bsc4I CCNNNNNNNGG 4 cut(s) 25, 145, 146, 291
BseBI CCWGG 2 cut(s) 122, 297
BseDI CCNNGG 2 cut(s) 48, 296
BseGI GGATG 2 cut(s) 160, 207
BseLI CCNNNNNNNGG 4 cut(s) 25, 145, 146, 291
BshFI GGCC 3 cut(s) 47, 138, 295
BsiSI CCGG 1 cut(s) 65
BslI CCNNNNNNNGG 4 cut(s) 25, 145, 146, 291
BsmI GAATGC 1 cut(s) 181
BsnI GGCC 3 cut(s) 47, 138, 295
Bsp143I GATC 2 cut(s) 9, 108
BspANI GGCC 3 cut(s) 47, 138, 295
BspMI ACCTGC 1 cut(s) 145
BssECI CCNNGG 2 cut(s) 48, 296
BssMI GATC 2 cut(s) 9, 108
Bst2UI CCWGG 2 cut(s) 122, 297
BstAPI GCANNNNNTGC 1 cut(s) 202
BstC8I GCNNGC 3 cut(s) 70, 152, 239
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 160, 207
BstKTI GATC 2 cut(s) 12, 111
BstMBI GATC 2 cut(s) 9, 108
BstMWI GCNNNNNNNGC 2 cut(s) 193, 202
BstNI CCWGG 2 cut(s) 122, 297
BstNSI RCATGY 2 cut(s) 173, 241
BstSCI CCNGG 2 cut(s) 120, 295
BstX2I RGATCY 1 cut(s) 9
BstYI RGATCY 1 cut(s) 9
BsuRI GGCC 3 cut(s) 47, 138, 295
BtsCI GGATG 2 cut(s) 160, 207
BtsIMutI CAGTG 1 cut(s) 30
BveI ACCTGC 1 cut(s) 145
Cac8I GCNNGC 3 cut(s) 70, 152, 239
Cfr13I GGNCC 1 cut(s) 137
CviAII CATG 4 cut(s) 97, 170, 238, 291
DdeI CTNAG 1 cut(s) 6
DpnI GATC 2 cut(s) 11, 110
DpnII GATC 2 cut(s) 9, 108
EaeI YGGCCR 1 cut(s) 293
Eco32I GATATC 1 cut(s) 78
Eco57I CTGAAG 1 cut(s) 173
EcoRI GAATTC 1 cut(s) 113
EcoRII CCWGG 2 cut(s) 120, 295
EcoRV GATATC 1 cut(s) 78
FaeI CATG 4 cut(s) 100, 173, 241, 294
FaiI YATR 4 cut(s) 98, 171, 239, 292
FatI CATG 4 cut(s) 96, 169, 237, 290
FokI GGATG 2 cut(s) 147, 214
FspBI CTAG 1 cut(s) 39
HaeIII GGCC 3 cut(s) 47, 138, 295
HapII CCGG 1 cut(s) 65
Hin1II CATG 4 cut(s) 100, 173, 241, 294
HindIII AAGCTT 1 cut(s) 185
HpaII CCGG 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 57, 91
Hpy188I TCNGA 2 cut(s) 82, 192
Hpy8I GTNNAC 2 cut(s) 57, 91
HpyCH4V TGCA 5 cut(s) 72, 154, 179, 196, 205
HpyF10VI GCNNNNNNNGC 2 cut(s) 193, 202
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 4 cut(s) 100, 173, 241, 294
Kzo9I GATC 2 cut(s) 9, 108
LmnI GCTCC 2 cut(s) 214, 304
LpnPI CCDG 6 cut(s) 78, 107, 134, 140, 218, 282
LweI GCATC 2 cut(s) 183, 192
MaeI CTAG 1 cut(s) 39
MalI GATC 2 cut(s) 11, 110
MboI GATC 2 cut(s) 9, 108
MfeI CAATTG 1 cut(s) 141
MflI RGATCY 1 cut(s) 9
MlsI TGGCCA 1 cut(s) 295
MluCI AATT 2 cut(s) 113, 141
MluNI TGGCCA 1 cut(s) 295
MnlI CCTC 5 cut(s) 58, 76, 139, 174, 295
Mox20I TGGCCA 1 cut(s) 295
MscI TGGCCA 1 cut(s) 295
MslI CAYNNNNRTG 1 cut(s) 174
Msp20I TGGCCA 1 cut(s) 295
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 122, 297
MunI CAATTG 1 cut(s) 141
Mva1269I GAATGC 1 cut(s) 181
MvaI CCWGG 2 cut(s) 122, 297
MwoI GCNNNNNNNGC 2 cut(s) 193, 202
NdeII GATC 2 cut(s) 9, 108
NlaIII CATG 4 cut(s) 100, 173, 241, 294
NspI RCATGY 2 cut(s) 173, 241
PaeI GCATGC 1 cut(s) 241
PctI GAATGC 1 cut(s) 181
PflMI CCANNNNNTGG 2 cut(s) 25, 291
Psp6I CCWGG 2 cut(s) 120, 295
PspGI CCWGG 2 cut(s) 120, 295
PspPI GGNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 174
Sau3AI GATC 2 cut(s) 9, 108
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 2 cut(s) 122, 297
SetI ASST 6 cut(s) 44, 87, 159, 189, 270, 309
SfaNI GCATC 2 cut(s) 183, 192
SmiMI CAYNNNNRTG 1 cut(s) 174
SphI GCATGC 1 cut(s) 241
Sse9I AATT 2 cut(s) 113, 141
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 2 cut(s) 120, 295
TaqI TCGA 2 cut(s) 111, 166
TasI AATT 2 cut(s) 113, 141
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 113, 149
TspRI CASTG 1 cut(s) 30
Van91I CCANNNNNTGG 2 cut(s) 25, 291
XapI RAATTY 1 cut(s) 113
XceI RCATGY 2 cut(s) 173, 241
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.