Rorug04G0039800

14 kDa zinc-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0003817
Physical Location & Seq
Forward (+)
6133550 .. 6133870
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0039800.1

Sequence Viewer

Length: 321 bp
ATGTGCTGCTCTTCTTATGGATTTCTTCATCTAAAAGTGGAAGGTGATTCAAAGTTATTGATTGACAGTTTTCATAGTTCCATTCAACCACCTTGGCGTATCAAAAACATTCTCAAAGACATCTTGTGTCTATCTAATCAGTTCCACAGTTTTAGCCTAAATCAAATTAAGAGAGAAGTCAATTTCTTAGCCGATGCTATTGCCAACACAAGACACAATTCTTCAACTCAAGTTTGGAGAAATTCTCTACCTCTTTCTGCTTGTTATGCTCATTTGTTTGACTATATGGGATTCGGCTACATTAAGGGTTCTTCTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HIT

Protein Analysis

106

Amino Acids

12.09

Weight (kDa)

8.77

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 69 9.3e-08 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 241
AgsI TTSAA 3 cut(s) 51, 86, 225
ApeKI GCWGC 1 cut(s) 6
ApoI RAATTY 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 56
BcgI CGANNNNNNTGC 2 cut(s) 182, 216
BisI GCNGC 1 cut(s) 7
BlsI GCNGC 1 cut(s) 8
BmsI GCATC 1 cut(s) 184
BplI GAGNNNNNCTC 2 cut(s) 229, 261
BpuEI CTTGAG 1 cut(s) 213
BsaJI CCNNGG 1 cut(s) 92
BseDI CCNNGG 1 cut(s) 92
BspQI GCTCTTC 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 92
BssT1I CCWWGG 1 cut(s) 92
Bst4CI ACNGT 2 cut(s) 68, 149
Bst6I CTCTTC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 266
CviJI RGCY 3 cut(s) 156, 191, 297
CviKI_1 RGCY 3 cut(s) 156, 191, 297
DdeI CTNAG 1 cut(s) 187
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
Eco130I CCWWGG 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 92
ErhI CCWWGG 1 cut(s) 92
FaiI YATR 5 cut(s) 18, 75, 267, 285, 287
Fnu4HI GCNGC 1 cut(s) 7
Fsp4HI GCNGC 1 cut(s) 7
GluI GCNGC 1 cut(s) 7
HinfI GANTC 2 cut(s) 47, 291
HphI GGTGA 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 2 cut(s) 68, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 1 cut(s) 187
LguI GCTCTTC 1 cut(s) 16
LweI GCATC 1 cut(s) 184
MboII GAAGA 4 cut(s) 3, 17, 213, 303
MluCI AATT 4 cut(s) 165, 181, 217, 241
MnlI CCTC 1 cut(s) 261
MseI TTAA 2 cut(s) 168, 303
MwoI GCNNNNNNNGC 1 cut(s) 266
PciSI GCTCTTC 1 cut(s) 16
PfeI GAWTC 2 cut(s) 47, 291
PkrI GCNGC 1 cut(s) 8
SapI GCTCTTC 1 cut(s) 16
SaqAI TTAA 2 cut(s) 168, 303
SatI GCNGC 1 cut(s) 7
SetI ASST 3 cut(s) 46, 94, 253
SfaNI GCATC 1 cut(s) 184
SgeI CNNG 5 cut(s) 105, 136, 222, 242, 273
SmlI CTYRAG 1 cut(s) 228
SmoI CTYRAG 1 cut(s) 228
Sse9I AATT 4 cut(s) 165, 181, 217, 241
StyI CCWWGG 1 cut(s) 92
TaaI ACNGT 2 cut(s) 68, 149
TasI AATT 4 cut(s) 165, 181, 217, 241
TfiI GAWTC 2 cut(s) 47, 291
Tru1I TTAA 2 cut(s) 168, 303
Tru9I TTAA 2 cut(s) 168, 303
TseI GCWGC 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 17, 62
XapI RAATTY 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.