Rorug04G0131300

Ribosomal L32p protein family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
21062023 .. 21064069
2047 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0131300.1

Sequence Viewer

Length: 222 bp
ATGATGGCTAGAGGAAAGAAGGGAGTTGCTCGACCTCATCCAACTGCTTCGGGGCTTGAAGACTCTTCAACCGCAACATCACCTTCTGCTCATCTTCAAATTGAATTGATTGATGAGAATGTTCAGAGGGAAACCATAAATCACAGATCCTTGAGGCATCCAAATATTGTCAGGTTCAAAGAGGTCTTGTTGACTCCAAGTCATTTAGCTACTGTCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.08

Weight (kDa)

9.68

Isoelectric Point (pI)

52.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 72
AclWI GGATC 1 cut(s) 141
AgsI TTSAA 5 cut(s) 59, 69, 98, 104, 178
AhdI GACNNNNNGTC 1 cut(s) 198
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
AlwI GGATC 1 cut(s) 141
AsuHPI GGTGA 1 cut(s) 72
BbsI GAAGAC 1 cut(s) 66
BfaI CTAG 1 cut(s) 9
BmeRI GACNNNNNGTC 1 cut(s) 198
BmsI GCATC 1 cut(s) 166
BpiI GAAGAC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 172
BseGI GGATG 2 cut(s) 37, 157
Bsp143I GATC 1 cut(s) 146
BspACI CCGC 1 cut(s) 72
BspPI GGATC 1 cut(s) 141
BssMI GATC 1 cut(s) 146
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 70
BstF5I GGATG 2 cut(s) 37, 157
BstKTI GATC 1 cut(s) 149
BstMBI GATC 1 cut(s) 146
BstV2I GAAGAC 1 cut(s) 66
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
BtsCI GGATG 2 cut(s) 37, 157
CviAII CATG 1 cut(s) 217
CviJI RGCY 3 cut(s) 8, 55, 209
CviKI_1 RGCY 3 cut(s) 8, 55, 209
DpnI GATC 1 cut(s) 148
DpnII GATC 1 cut(s) 146
DriI GACNNNNNGTC 1 cut(s) 198
Eam1104I CTCTTC 1 cut(s) 70
Eam1105I GACNNNNNGTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 70
FaeI CATG 1 cut(s) 220
FaiI YATR 2 cut(s) 137, 218
FatI CATG 1 cut(s) 216
FokI GGATG 2 cut(s) 24, 144
FspBI CTAG 1 cut(s) 9
Hin1II CATG 1 cut(s) 220
HincII GTYRAC 1 cut(s) 192
HindII GTYRAC 1 cut(s) 192
HinfI GANTC 2 cut(s) 62, 193
HphI GGTGA 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 1 cut(s) 126
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 2 cut(s) 13, 93
HpyCH4III ACNGT 1 cut(s) 214
Hsp92II CATG 1 cut(s) 220
Kzo9I GATC 1 cut(s) 146
LpnPI CCDG 1 cut(s) 157
LweI GCATC 1 cut(s) 166
MaeI CTAG 1 cut(s) 9
MalI GATC 1 cut(s) 148
MboI GATC 1 cut(s) 146
MboII GAAGA 3 cut(s) 57, 71, 86
MflI RGATCY 1 cut(s) 146
MluCI AATT 2 cut(s) 99, 104
MlyI GAGTC 2 cut(s) 56, 187
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 5 cut(s) 5, 45, 120, 147, 175
NdeII GATC 1 cut(s) 146
NlaIII CATG 1 cut(s) 220
PleI GAGTC 2 cut(s) 56, 187
PpsI GAGTC 2 cut(s) 56, 187
PsuI RGATCY 1 cut(s) 146
Sau3AI GATC 1 cut(s) 146
SchI GAGTC 2 cut(s) 56, 187
SetI ASST 5 cut(s) 37, 85, 176, 186, 211
SfaNI GCATC 1 cut(s) 166
SgeI CNNG 8 cut(s) 21, 42, 63, 68, 163, 184, 199, 210
SmlI CTYRAG 1 cut(s) 151
SmoI CTYRAG 1 cut(s) 151
Sse9I AATT 2 cut(s) 99, 104
SsiI CCGC 1 cut(s) 72
SspI AATATT 1 cut(s) 166
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 31
TasI AATT 2 cut(s) 99, 104
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.