Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000005

Orthogroup ID

OG0002792

Physical Location & Seq

Genomic Coordinates Forward (+)

14913038 .. 14913664

Gene Structure 627 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug05G0159900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 627 bp

ATGAGATCATTTACTTCTCCTGATAAAGTTTACTCTCTGGCTTGCCTTATTTTGTATGTCCACCTGGTTTTATCACCAGTCATTGGTTTCGCTTCTGCTAGTTCAACTGAAGCAGAGGCTCTTATCAAATGGAAGGCTAGTTTTGAGTACCAAACTCAGAATAACAATCCTACCTCATGGACTTACTTTCCCAGTAATGCCACAAATTCTTCCACCAATTCAAACCCATGCAGTGTTTGGACTGGGATTTCATGCAACAATGCAGGAAGTGTCAACATGATGAACCTCACCGATTATGGTATTCAAGGTACGCTGCATGAATTTCCATTCATTTCGTTACCTAATCTTGAATATGTTGACCTTAGCATGAATAAACTCTATGATGCCATCCCACCTCAGATTAGTTCCCTCTCCAAACTCATCTATCTTGATCTATCTTACAATCAGTTTACTGGGAAAATCCCACCAGAAATTGGCCTGCTAACAAATCTTGAGGTCCTTCATCTAAATGAAAATCAGTTAAATGGCTCAATCCCCCAAGAACTAGGTCAACTCAATCCTCTTTACGAGCTTAATTGCTCTGTACGCAAACAAACTAGAAGGTCCAATTCCTGCTTCTCTGGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase_Tyr

Protein Analysis

208

Amino Acids

23.11

Weight (kDa)

5.3

Isoelectric Point (pI)

32.58

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LRRNT_2	PF08263	35 - 86	1.8e-06	Leucine rich repeat N-terminal domain
LRR_14	PF23598	112 - 196	2e-08	Leucine-rich repeat region
LRR_4	PF12799	139 - 177	9e-07	Leucine Rich repeats (2 copies)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002792)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G54590 AT5G54590 AT5G54590 AT5G54590
fragaria_vesca	FvH4_3g02990 FvH4_3g21590 FvH4_3g21590 FvH4_3g21590 FvH4_3g21590
malus_domestica	MD03G1214400.v1.1 MD05G1335500.v1.1 MD11G1229400.v1.1
prunus_persica	Prupe.4G029800_v2.0.a1 Prupe.4G200300_v2.0.a1 Prupe.4G200300_v2.0.a1 Prupe.4G200300_v2.0.a1 Prupe.4G200300_v2.0.a1
pyrus_communis	pycom03g16310 pycom11g20290
rosa_chinensis	RchiOBHm_Chr5g0004621 RchiOBHm_Chr5g0037051
rosa_laevigata	RLG00000031246 RLG00000033746
rosa_multiflora	Rmu_co8453033.1_g000001 Rmu_sc0014990.1_g000001
rosa_roxburghii	Rroxscaffold_1G00043900 Rroxscaffold_1G00070920
rosa_rugosa	Rorug04G0412600 Rorug05G0159900 Rorug05G0160000
rosa_samantha	Rh5AG040700 Rh5AG252100 Rh5BG040400 Rh5BG253800 Rh5CG044100 Rh5DG040000 Rh5DG262400
rosa_wichuraiana	Rw5G003910 Rw5G023240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	83, 473
AcsI	RAATTY	2 cut(s)	205, 320
AcuI	CTGAAG	1 cut(s)	129
AfaI	GTAC	3 cut(s)	149, 310, 585
AfiI	CCNNNNNNNGG	2 cut(s)	83, 473
AgsI	TTSAA	4 cut(s)	105, 222, 305, 350
AjnI	CCWGG	1 cut(s)	63
AjuI	GAANNNNNNNTTGG	1 cut(s)	599
AluBI	AGCT	1 cut(s)	571
AluI	AGCT	1 cut(s)	571
AoxI	GGCC	1 cut(s)	475
ApeKI	GCWGC	1 cut(s)	313
ApoI	RAATTY	2 cut(s)	205, 320
AspS9I	GGNCC	2 cut(s)	496, 603
AsuHPI	GGTGA	2 cut(s)	66, 280
AvaII	GGWCC	2 cut(s)	496, 603
BbvI	GCAGC	1 cut(s)	300
BccI	CCATC	1 cut(s)	395
BciT130I	CCWGG	1 cut(s)	65
BfaI	CTAG	4 cut(s)	99, 138, 545, 597
BisI	GCNGC	1 cut(s)	314
BlsI	GCNGC	1 cut(s)	315
Bme1390I	CCNGG	1 cut(s)	65
Bme18I	GGWCC	2 cut(s)	496, 603
BmgT120I	GGNCC	2 cut(s)	496, 603
BmrFI	CCNGG	1 cut(s)	65
BmrI	ACTGGG	3 cut(s)	186, 252, 462
BmsI	GCATC	1 cut(s)	373
BmuI	ACTGGG	3 cut(s)	186, 252, 462
Bpu10I	CCTNAGC	1 cut(s)	362
BpuEI	CTTGAG	1 cut(s)	512
Bsc4I	CCNNNNNNNGG	2 cut(s)	83, 473
Bse1I	ACTGG	4 cut(s)	77, 192, 247, 457
BseBI	CCWGG	1 cut(s)	65
BseGI	GGATG	1 cut(s)	387
BseLI	CCNNNNNNNGG	2 cut(s)	83, 473
BseMII	CTCAG	2 cut(s)	170, 410
BseNI	ACTGG	4 cut(s)	77, 192, 247, 457
BseXI	GCAGC	1 cut(s)	300
BshFI	GGCC	1 cut(s)	477
BslI	CCNNNNNNNGG	2 cut(s)	83, 473
BsnI	GGCC	1 cut(s)	477
Bsp143I	GATC	2 cut(s)	5, 430
BspANI	GGCC	1 cut(s)	477
BspCNI	CTCAG	2 cut(s)	169, 409
BsrI	ACTGG	4 cut(s)	77, 192, 247, 457
BssMI	GATC	2 cut(s)	5, 430
Bst2UI	CCWGG	1 cut(s)	65
BstC8I	GCNNGC	2 cut(s)	43, 479
BstDEI	CTNAG	3 cut(s)	156, 362, 396
BstF5I	GGATG	1 cut(s)	387
BstKTI	GATC	2 cut(s)	8, 433
BstMBI	GATC	2 cut(s)	5, 430
BstMWI	GCNNNNNNNGC	1 cut(s)	585
BstNI	CCWGG	1 cut(s)	65
BstSCI	CCNGG	1 cut(s)	63
BstV1I	GCAGC	1 cut(s)	300
BsuRI	GGCC	1 cut(s)	477
BtsCI	GGATG	1 cut(s)	387
BtsI	GCAGTG	1 cut(s)	238
BtsIMutI	CAGTG	1 cut(s)	238
Cac8I	GCNNGC	2 cut(s)	43, 479
Cfr13I	GGNCC	2 cut(s)	496, 603
CsiI	ACCWGGT	1 cut(s)	63
Csp6I	GTAC	3 cut(s)	148, 309, 584
CviAII	CATG	6 cut(s)	177, 228, 252, 277, 317, 367
CviJI	RGCY	6 cut(s)	41, 119, 137, 477, 528, 571
CviKI_1	RGCY	6 cut(s)	41, 119, 137, 477, 528, 571
CviQI	GTAC	3 cut(s)	148, 309, 584
DdeI	CTNAG	3 cut(s)	156, 362, 396
DpnI	GATC	2 cut(s)	7, 432
DpnII	GATC	2 cut(s)	5, 430
Eco47I	GGWCC	2 cut(s)	496, 603
Eco57I	CTGAAG	1 cut(s)	129
EcoO109I	RGGNCCY	1 cut(s)	496
EcoRII	CCWGG	1 cut(s)	63
FaeI	CATG	6 cut(s)	180, 231, 255, 280, 320, 370
FatI	CATG	6 cut(s)	176, 227, 251, 276, 316, 366
Fnu4HI	GCNGC	1 cut(s)	314
FokI	GGATG	1 cut(s)	374
Fsp4HI	GCNGC	1 cut(s)	314
FspBI	CTAG	4 cut(s)	99, 138, 545, 597
GluI	GCNGC	1 cut(s)	314
HaeIII	GGCC	1 cut(s)	477
Hin1II	CATG	6 cut(s)	180, 231, 255, 280, 320, 370
HincII	GTYRAC	3 cut(s)	274, 358, 551
HindII	GTYRAC	3 cut(s)	274, 358, 551
HphI	GGTGA	2 cut(s)	66, 280
Hpy166II	GTNNAC	6 cut(s)	31, 61, 274, 358, 450, 551
Hpy188I	TCNGA	2 cut(s)	159, 399
Hpy188III	TCNNGA	4 cut(s)	20, 347, 428, 491
Hpy8I	GTNNAC	6 cut(s)	31, 61, 274, 358, 450, 551
HpyAV	CCTTC	3 cut(s)	127, 509, 594
HpyCH4V	TGCA	4 cut(s)	231, 255, 263, 316
HpyF10VI	GCNNNNNNNGC	1 cut(s)	585
HpyF3I	CTNAG	3 cut(s)	156, 362, 396
Hsp92II	CATG	6 cut(s)	180, 231, 255, 280, 320, 370
Kzo9I	GATC	2 cut(s)	5, 430
Lsp1109I	GCAGC	1 cut(s)	300
LweI	GCATC	1 cut(s)	373
MabI	ACCWGGT	1 cut(s)	63
MaeI	CTAG	4 cut(s)	99, 138, 545, 597
MaeIII	GTNAC	1 cut(s)	336
MalI	GATC	2 cut(s)	7, 432
MboI	GATC	2 cut(s)	5, 430
MboII	GAAGA	1 cut(s)	201
MluCI	AATT	6 cut(s)	205, 217, 320, 471, 574, 607
MnlI	CCTC	7 cut(s)	109, 184, 296, 405, 419, 487, 570
MseI	TTAA	2 cut(s)	521, 573
MslI	CAYNNNNRTG	1 cut(s)	507
MspR9I	CCNGG	1 cut(s)	65
MvaI	CCWGG	1 cut(s)	65
MwoI	GCNNNNNNNGC	1 cut(s)	585
NdeII	GATC	2 cut(s)	5, 430
NlaIII	CATG	6 cut(s)	180, 231, 255, 280, 320, 370
PflMI	CCANNNNNTGG	2 cut(s)	83, 473
PkrI	GCNGC	1 cut(s)	315
PpuMI	RGGWCCY	1 cut(s)	496
Psp5II	RGGWCCY	1 cut(s)	496
Psp6I	CCWGG	1 cut(s)	63
PspGI	CCWGG	1 cut(s)	63
PspPI	GGNCC	2 cut(s)	496, 603
PspPPI	RGGWCCY	1 cut(s)	496
RsaI	GTAC	3 cut(s)	149, 310, 585
RsaNI	GTAC	3 cut(s)	148, 309, 584
RseI	CAYNNNNRTG	1 cut(s)	507
SaqAI	TTAA	2 cut(s)	521, 573
SatI	GCNGC	1 cut(s)	314
Sau3AI	GATC	2 cut(s)	5, 430
Sau96I	GGNCC	2 cut(s)	496, 603
ScrFI	CCNGG	1 cut(s)	65
SexAI	ACCWGGT	1 cut(s)	63
SfaNI	GCATC	1 cut(s)	373
SinI	GGWCC	2 cut(s)	496, 603
SmiMI	CAYNNNNRTG	1 cut(s)	507
SmlI	CTYRAG	1 cut(s)	491
SmoI	CTYRAG	1 cut(s)	491
Sse9I	AATT	6 cut(s)	205, 217, 320, 471, 574, 607
SspMI	CTAG	4 cut(s)	99, 138, 545, 597
StyD4I	CCNGG	1 cut(s)	63
TasI	AATT	6 cut(s)	205, 217, 320, 471, 574, 607
Tru1I	TTAA	2 cut(s)	521, 573
Tru9I	TTAA	2 cut(s)	521, 573
TscAI	CASTG	1 cut(s)	238
TseI	GCWGC	1 cut(s)	313
TspDTI	ATGAA	7 cut(s)	240, 296, 319, 333, 383, 491, 525
TspRI	CASTG	1 cut(s)	238
Van91I	CCANNNNNTGG	2 cut(s)	83, 473
VpaK11BI	GGWCC	2 cut(s)	496, 603
XapI	RAATTY	2 cut(s)	205, 320
XcmI	CCANNNNNNNNNTGG	1 cut(s)	234
XspI	CTAG	4 cut(s)	99, 138, 545, 597

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.