Rorug05G0506500

Senescence-associated protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
68858099 .. 68858668
570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0506500.1

Sequence Viewer

Length: 519 bp
ATGGACGTATCAAGATCAAACTTGGGTGTTACAAGGCCATCAATGCTGTTTCTAGCAGCAAACATGCGGAAAGTATTGGGGCATCCCACTTTAATGGGAAATCTTTTAGGATATGTCCCAACAAAGACACAAGAAAGTGAGGCAACTCTTCAAAGCTTGGTTGCTATACTACGGGAAGGCATTGAGAAATTTAAAGTGAATTATGATAATGAAGTTAGCGGAGATGATATCTGCCAACATTTCAAAGAGCATGAAGATTTAATGGGTAAGAATGATATAAATAACTATACATGTAGCAGTTGGTGCAGGTTTGGCTTCTATGAAGCCAATTTTGGATGGGGAAAGCCATCATGGGTCACTATGCCAGGTATGCCAATCAAGAATGTAATTATATTGATTGATGCAAAAGATGGTGAAGGCGTAGAAGCGTTAGTGAGTTTTAAAGAAGACGACATGGCTATAATTGAAACCAATAAGGAGCTGCTTGCATATTCATCTCTCAATCCTATTGCTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.21

Weight (kDa)

4.95

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transferase PF02458 10 - 161 9.4e-21 Transferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 297
AciI CCGC 2 cut(s) 67, 219
AcsI RAATTY 1 cut(s) 188
AflIII ACRYGT 1 cut(s) 290
AgsI TTSAA 3 cut(s) 152, 244, 467
AjnI CCWGG 1 cut(s) 364
AjuI GAANNNNNNNTTGG 2 cut(s) 315, 347
AluBI AGCT 2 cut(s) 156, 481
AluI AGCT 2 cut(s) 156, 481
AoxI GGCC 1 cut(s) 35
ApeKI GCWGC 2 cut(s) 56, 481
ApoI RAATTY 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 425
BbsI GAAGAC 1 cut(s) 453
BbvI GCAGC 2 cut(s) 68, 468
BccI CCATC 4 cut(s) 46, 330, 355, 404
BciT130I CCWGG 1 cut(s) 366
BfaI CTAG 1 cut(s) 53
BfuAI ACCTGC 1 cut(s) 297
BisI GCNGC 2 cut(s) 57, 482
BlsI GCNGC 2 cut(s) 58, 483
Bme1390I CCNGG 1 cut(s) 366
BmrFI CCNGG 1 cut(s) 366
BmsI GCATC 2 cut(s) 91, 391
BpiI GAAGAC 1 cut(s) 453
BseBI CCWGG 1 cut(s) 366
BseGI GGATG 2 cut(s) 82, 341
BseXI GCAGC 2 cut(s) 68, 468
BsgI GTGCAG 1 cut(s) 325
BshFI GGCC 1 cut(s) 37
BslFI GGGAC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 101
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 1 cut(s) 14
BspACI CCGC 2 cut(s) 67, 219
BspANI GGCC 1 cut(s) 37
BspMI ACCTGC 1 cut(s) 297
BssMI GATC 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 366
Bst6I CTCTTC 1 cut(s) 153
BstAPI GCANNNNNTGC 1 cut(s) 303
BstC8I GCNNGC 1 cut(s) 486
BstF5I GGATG 2 cut(s) 82, 341
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstMWI GCNNNNNNNGC 4 cut(s) 43, 303, 312, 370
BstNI CCWGG 1 cut(s) 366
BstNSI RCATGY 2 cut(s) 67, 294
BstSCI CCNGG 1 cut(s) 364
BstV1I GCAGC 2 cut(s) 68, 468
BstV2I GAAGAC 1 cut(s) 453
BstXI CCANNNNNNTGG 1 cut(s) 94
BsuRI GGCC 1 cut(s) 37
BtsCI GGATG 2 cut(s) 82, 341
BveI ACCTGC 1 cut(s) 297
Cac8I GCNNGC 1 cut(s) 486
CviAII CATG 5 cut(s) 64, 251, 291, 351, 454
CviJI RGCY 7 cut(s) 37, 156, 315, 326, 346, 458, 481
CviKI_1 RGCY 7 cut(s) 37, 156, 315, 326, 346, 458, 481
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
DraI TTTAAA 2 cut(s) 193, 442
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
Eco32I GATATC 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 364
EcoRV GATATC 1 cut(s) 229
FaeI CATG 5 cut(s) 67, 254, 294, 354, 457
FaqI GGGAC 1 cut(s) 101
FatI CATG 5 cut(s) 63, 250, 290, 350, 453
Fnu4HI GCNGC 2 cut(s) 57, 482
FokI GGATG 2 cut(s) 69, 348
Fsp4HI GCNGC 2 cut(s) 57, 482
FspBI CTAG 1 cut(s) 53
GluI GCNGC 2 cut(s) 57, 482
HaeIII GGCC 1 cut(s) 37
Hin1II CATG 5 cut(s) 67, 254, 294, 354, 457
HindIII AAGCTT 1 cut(s) 154
HphI GGTGA 1 cut(s) 425
Hpy188III TCNNGA 2 cut(s) 12, 379
HpyAV CCTTC 2 cut(s) 170, 410
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 3 cut(s) 306, 404, 488
HpyF10VI GCNNNNNNNGC 4 cut(s) 43, 303, 312, 370
HpySE526I ACGT 1 cut(s) 6
Hsp92II CATG 5 cut(s) 67, 254, 294, 354, 457
Kzo9I GATC 1 cut(s) 14
LmnI GCTCC 1 cut(s) 478
LpnPI CCDG 3 cut(s) 292, 351, 378
Lsp1109I GCAGC 2 cut(s) 68, 468
LweI GCATC 2 cut(s) 91, 391
MaeI CTAG 1 cut(s) 53
MaeII ACGT 1 cut(s) 6
MaeIII GTNAC 2 cut(s) 28, 355
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 3 cut(s) 140, 266, 458
MluCI AATT 5 cut(s) 188, 199, 328, 387, 462
MnlI CCTC 1 cut(s) 133
MseI TTAA 5 cut(s) 92, 192, 260, 441, 517
MslI CAYNNNNRTG 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 366
MvaI CCWGG 1 cut(s) 366
MwoI GCNNNNNNNGC 4 cut(s) 43, 303, 312, 370
NdeII GATC 1 cut(s) 14
NlaIII CATG 5 cut(s) 67, 254, 294, 354, 457
NmuCI GTSAC 1 cut(s) 355
NspI RCATGY 2 cut(s) 67, 294
PciI ACATGT 1 cut(s) 290
PkrI GCNGC 2 cut(s) 58, 483
PscI ACATGT 1 cut(s) 290
Psp6I CCWGG 1 cut(s) 364
PspGI CCWGG 1 cut(s) 364
RseI CAYNNNNRTG 1 cut(s) 92
SaqAI TTAA 5 cut(s) 92, 192, 260, 441, 517
SatI GCNGC 2 cut(s) 57, 482
Sau3AI GATC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 366
SetI ASST 5 cut(s) 9, 158, 311, 370, 483
SfaNI GCATC 2 cut(s) 91, 391
SmiMI CAYNNNNRTG 1 cut(s) 92
Sse9I AATT 5 cut(s) 188, 199, 328, 387, 462
SsiI CCGC 2 cut(s) 67, 219
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 1 cut(s) 364
TaiI ACGT 1 cut(s) 9
TasI AATT 5 cut(s) 188, 199, 328, 387, 462
Tru1I TTAA 5 cut(s) 92, 192, 260, 441, 517
Tru9I TTAA 5 cut(s) 92, 192, 260, 441, 517
TseFI GTSAC 1 cut(s) 355
TseI GCWGC 2 cut(s) 56, 481
Tsp45I GTSAC 1 cut(s) 355
TspDTI ATGAA 4 cut(s) 225, 267, 336, 483
XapI RAATTY 1 cut(s) 188
XceI RCATGY 2 cut(s) 67, 294
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.