Rorug06G0195300

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
31575417 .. 31578464
3048 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0195300.1

Sequence Viewer

Length: 318 bp
ATGGATCCTATGAAGAGGCGATTACCCACTGGAGAATGGGTTTCCATTGTTGATAGTGCAATATCCATGTATAATGCACACAAGGGCAGGAAAGGCCGAAGTTCGCCTCTATGGAAAAATTTGTCGGGTATTCCTCCTCAACCTAACAGCAATGAGTGTGGCTACTTTATCATGCGATACATGAGAGACATCATTGAGGATAAAGACTTTTCATTTGTTACCAAGTGGGAGAGGAGAAGCAACCAAGTTTATACCCAAGTGGATATTGATGAGATGAGGAATGAGTGGGCTAGGTTTGTGGTTAATAGATATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.54

Weight (kDa)

9.41

Isoelectric Point (pI)

44.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 118
Alw26I GTCTC 1 cut(s) 180
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 118
ArsI GACNNNNNNTTYG 2 cut(s) 197, 229
BamHI GGATCC 1 cut(s) 4
BcoDI GTCTC 1 cut(s) 180
BfaI CTAG 1 cut(s) 291
BmiI GGNNCC 1 cut(s) 6
BpmI CTGGAG 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 24, 54
Bse1I ACTGG 1 cut(s) 34
Bse3DI GCAATG 1 cut(s) 157
BseMI GCAATG 1 cut(s) 157
BseNI ACTGG 1 cut(s) 34
BseRI GAGGAG 2 cut(s) 126, 247
BshFI GGCC 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 180
BsnI GGCC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 4
BspANI GGCC 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 4
Bst6I CTCTTC 1 cut(s) 8
BstKTI GATC 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 180
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 93
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 27
CspCI CAANNNNNGTGG 2 cut(s) 139, 174
CviAII CATG 3 cut(s) 67, 172, 181
CviJI RGCY 3 cut(s) 96, 162, 290
CviKI_1 RGCY 3 cut(s) 96, 162, 290
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
FaeI CATG 3 cut(s) 70, 175, 184
FaiI YATR 8 cut(s) 11, 68, 72, 112, 173, 182, 252, 312
FatI CATG 3 cut(s) 66, 171, 180
FspBI CTAG 1 cut(s) 291
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 96
Hin1II CATG 3 cut(s) 70, 175, 184
HpyCH4V TGCA 2 cut(s) 59, 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
Hsp92II CATG 3 cut(s) 70, 175, 184
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 15, 73
MaeI CTAG 1 cut(s) 291
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 1 cut(s) 25
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 118
MnlI CCTC 7 cut(s) 9, 117, 144, 147, 190, 225, 270
MseI TTAA 1 cut(s) 303
MwoI GCNNNNNNNGC 1 cut(s) 93
NdeII GATC 1 cut(s) 4
NlaIII CATG 3 cut(s) 70, 175, 184
NlaIV GGNNCC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 303
Sau3AI GATC 1 cut(s) 4
SetI ASST 2 cut(s) 145, 296
Sse9I AATT 1 cut(s) 118
SspMI CTAG 1 cut(s) 291
TasI AATT 1 cut(s) 118
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 26, 201
TspRI CASTG 1 cut(s) 34
XapI RAATTY 1 cut(s) 118
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.