Rorug07G0250900

RIBOSOMAL protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0004086
Physical Location & Seq
Reverse (-)
23203401 .. 23205143
1743 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0250900.1

Sequence Viewer

Length: 252 bp
ATGGGTTTCCGGTTGCCTAGAATCGCTAATACAAAGACATCAGATATCCCAAAAGGCTACTTTGCAGTCTATGTTGGAGAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAGTCAAGCTGAAGAAGAATTTGGATACCATCATCCAATGGGTGGTATCACAATTCCTTGCAGTGAAGACATGTTCATTCATCTCACTTCCCGCTTAAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L18p

Protein Analysis

83

Amino Acids

9.45

Weight (kDa)

6.82

Isoelectric Point (pI)

36.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 10 - 80 1.1e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AciI CCGC 1 cut(s) 238
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 188
AflII CTTAAG 1 cut(s) 241
AflIII ACRYGT 1 cut(s) 216
AgsI TTSAA 1 cut(s) 121
AjuI GAANNNNNNNTTGG 4 cut(s) 117, 149, 150, 182
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
ApoI RAATTY 1 cut(s) 164
BbsI GAAGAC 1 cut(s) 219
BccI CCATC 1 cut(s) 183
BciVI GTATCC 1 cut(s) 164
BfaI CTAG 1 cut(s) 18
BfrI CTTAAG 1 cut(s) 241
BfuI GTATCC 1 cut(s) 164
BmiI GGNNCC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 219
BsaWI WCCGGW 1 cut(s) 9
Bsc4I CCNNNNNNNGG 1 cut(s) 188
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 137
BsiSI CCGG 1 cut(s) 10
BslI CCNNNNNNNGG 1 cut(s) 188
BspACI CCGC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 105
BspTI CTTAAG 1 cut(s) 241
BstAFI CTTAAG 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 1 cut(s) 178
BstNSI RCATGY 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 219
BsuI GTATCC 1 cut(s) 164
BtsCI GGATG 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 214
CviAII CATG 1 cut(s) 217
CviJI RGCY 3 cut(s) 57, 84, 155
CviKI_1 RGCY 3 cut(s) 57, 84, 155
DdeI CTNAG 1 cut(s) 146
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 177
EcoRV GATATC 1 cut(s) 46
FaeI CATG 1 cut(s) 220
FaiI YATR 3 cut(s) 72, 115, 218
FatI CATG 1 cut(s) 216
FauI CCCGC 1 cut(s) 245
FokI GGATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 18
HapII CCGG 1 cut(s) 10
Hin1II CATG 1 cut(s) 220
HinfI GANTC 2 cut(s) 21, 148
HpaII CCGG 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 137
HpyCH4V TGCA 2 cut(s) 65, 207
HpyF3I CTNAG 1 cut(s) 146
Hsp92II CATG 1 cut(s) 220
LpnPI CCDG 3 cut(s) 23, 98, 122
MaeI CTAG 1 cut(s) 18
MboII GAAGA 4 cut(s) 100, 170, 173, 224
MluCI AATT 2 cut(s) 164, 198
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 55
MseI TTAA 1 cut(s) 242
MspCI CTTAAG 1 cut(s) 241
MspI CCGG 1 cut(s) 10
NlaIII CATG 1 cut(s) 220
NlaIV GGNNCC 1 cut(s) 105
NspI RCATGY 1 cut(s) 220
PciI ACATGT 1 cut(s) 216
PfeI GAWTC 1 cut(s) 21
PflMI CCANNNNNTGG 1 cut(s) 188
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
PscI ACATGT 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 242
SchI GAGTC 1 cut(s) 157
SetI ASST 2 cut(s) 130, 157
SgeI CNNG 7 cut(s) 22, 30, 97, 149, 164, 216, 229
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 2 cut(s) 164, 198
SsiI CCGC 1 cut(s) 238
SspMI CTAG 1 cut(s) 18
TasI AATT 2 cut(s) 164, 198
TfiI GAWTC 1 cut(s) 21
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 211, 215
TspRI CASTG 1 cut(s) 214
Van91I CCANNNNNTGG 1 cut(s) 188
Vha464I CTTAAG 1 cut(s) 241
XapI RAATTY 1 cut(s) 164
XceI RCATGY 1 cut(s) 220
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.