Rh1AG344800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
58092562 .. 58092768
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG344800.1

Sequence Viewer

Length: 207 bp
ATGGTCGGCGAGGTCGCAGGTGGAGGAGACGTTGGAGAGGAAGTGGTCGGCGTCGGACTTGACGATGTCGAGGACCTAGGAGGATTTATGGAGATTGGAGAGGTCGCGGATCTTGGCGCTGACGTGGTCGGCGAGGTCGCAGGTGGAGGAGACGTTGGAGAGGACGTGGTCAGCGTCGGACTTGATAATGTCGAGGACCTAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

6.52

Weight (kDa)

4.05

Isoelectric Point (pI)

17.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 8, 131
Acc36I ACCTGC 2 cut(s) 8, 131
AccII CGCG 1 cut(s) 107
AciI CCGC 1 cut(s) 107
AclWI GGATC 1 cut(s) 117
AcyI GRCGYC 1 cut(s) 51
AjiI CACGTC 2 cut(s) 124, 166
Alw26I GTCTC 2 cut(s) 21, 144
AlwI GGATC 1 cut(s) 117
AspA2I CCTAGG 2 cut(s) 76, 199
AspLEI GCGC 1 cut(s) 119
AspS9I GGNCC 2 cut(s) 73, 196
AvaII GGWCC 2 cut(s) 73, 196
AvrII CCTAGG 2 cut(s) 76, 199
BcoDI GTCTC 2 cut(s) 21, 144
BfaI CTAG 2 cut(s) 77, 200
BfoI RGCGCY 1 cut(s) 120
BfuAI ACCTGC 2 cut(s) 8, 131
BlnI CCTAGG 2 cut(s) 76, 199
Bme18I GGWCC 2 cut(s) 73, 196
BmgBI CACGTC 2 cut(s) 124, 166
BmgT120I GGNCC 2 cut(s) 73, 196
BsaHI GRCGYC 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 76, 199
BsaXI ACNNNNNCTCC 8 cut(s) 15, 27, 45, 57, 138, 150, 168, 180
BseDI CCNNGG 2 cut(s) 76, 199
BseRI GAGGAG 2 cut(s) 39, 162
Bsh1236I CGCG 1 cut(s) 107
BsmAI GTCTC 2 cut(s) 21, 144
BsmBI CGTCTC 2 cut(s) 21, 144
Bsp143I GATC 1 cut(s) 109
BspACI CCGC 1 cut(s) 107
BspFNI CGCG 1 cut(s) 107
BspMI ACCTGC 2 cut(s) 8, 131
BspPI GGATC 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 76, 199
BssMI GATC 1 cut(s) 109
BssNI GRCGYC 1 cut(s) 51
BssT1I CCWWGG 2 cut(s) 76, 199
BstACI GRCGYC 1 cut(s) 51
BstFNI CGCG 1 cut(s) 107
BstH2I RGCGCY 1 cut(s) 120
BstHHI GCGC 1 cut(s) 119
BstKTI GATC 1 cut(s) 112
BstMAI GTCTC 2 cut(s) 21, 144
BstMBI GATC 1 cut(s) 109
BstUI CGCG 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
BtrI CACGTC 2 cut(s) 124, 166
BveI ACCTGC 2 cut(s) 8, 131
CfoI GCGC 1 cut(s) 119
Cfr13I GGNCC 2 cut(s) 73, 196
CseI GACGC 2 cut(s) 40, 163
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco130I CCWWGG 2 cut(s) 76, 199
Eco47I GGWCC 2 cut(s) 73, 196
EcoO109I RGGNCCY 2 cut(s) 73, 196
EcoT14I CCWWGG 2 cut(s) 76, 199
ErhI CCWWGG 2 cut(s) 76, 199
Esp3I CGTCTC 2 cut(s) 21, 144
FaiI YATR 1 cut(s) 89
FspBI CTAG 2 cut(s) 77, 200
GlaI GCGC 1 cut(s) 118
HaeII RGCGCY 1 cut(s) 120
HgaI GACGC 2 cut(s) 40, 163
HhaI GCGC 1 cut(s) 119
Hin1I GRCGYC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
Hpy188I TCNGA 2 cut(s) 56, 179
Hpy99I CGWCG 2 cut(s) 56, 179
HpyCH4IV ACGT 4 cut(s) 30, 123, 153, 165
HpySE526I ACGT 4 cut(s) 30, 123, 153, 165
Hsp92I GRCGYC 1 cut(s) 51
HspAI GCGC 1 cut(s) 117
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 2 cut(s) 3, 126
MaeI CTAG 2 cut(s) 77, 200
MaeII ACGT 4 cut(s) 30, 123, 153, 165
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MflI RGATCY 1 cut(s) 109
MmeI TCCRAC 4 cut(s) 13, 34, 136, 157
MvnI CGCG 1 cut(s) 107
NdeII GATC 1 cut(s) 109
PaqCI CACCTGC 2 cut(s) 8, 131
PcsI WCGNNNNNNNCGW 3 cut(s) 60, 129, 171
PflFI GACNNNGTC 3 cut(s) 65, 125, 167
PpuMI RGGWCCY 2 cut(s) 73, 196
Psp5II RGGWCCY 2 cut(s) 73, 196
PspPI GGNCC 2 cut(s) 73, 196
PspPPI RGGWCCY 2 cut(s) 73, 196
PsuI RGATCY 1 cut(s) 109
PsyI GACNNNGTC 3 cut(s) 65, 125, 167
Sau3AI GATC 1 cut(s) 109
Sau96I GGNCC 2 cut(s) 73, 196
SinI GGWCC 2 cut(s) 73, 196
SsiI CCGC 1 cut(s) 107
SspMI CTAG 2 cut(s) 77, 200
StyI CCWWGG 2 cut(s) 76, 199
TaiI ACGT 4 cut(s) 33, 126, 156, 168
TaqI TCGA 2 cut(s) 69, 192
Tth111I GACNNNGTC 3 cut(s) 65, 125, 167
VpaK11BI GGWCC 2 cut(s) 73, 196
XmaJI CCTAGG 2 cut(s) 76, 199
XspI CTAG 2 cut(s) 77, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.