Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0006912

Physical Location & Seq

Genomic Coordinates Forward (+)

42289643 .. 42289900

Gene Structure 258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG331100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

ATGGTCGACGAGGTCGCAGGTGGAGGAGACGTTGGAGAGGACGTGGTCAGCGTCGGAATTGACGATGTCGAGGACCTGGGAGGATTTCTGGAGATTGGAGAGGTCGTGGATCTTGGCGCTGACGTGGTCGGCGAGATTGCAGGTGGAGGAGAAGTTGGAGAGGACGTGGTCGGCGTCGGAATTGACGATGTCGAGGACCTGGGAGGATTTCTGGAGATTGGAGAGGTCGCAGATCTTGGCGCTGACGTGGTCAGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

85

Amino Acids

8.27

Weight (kDa)

4.05

Isoelectric Point (pI)

12.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006912)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g07420
rosa_laevigata	RLG00000000660 RLG00000002907 RLG00000007972 RLG00000009435
rosa_multiflora	Rmu_sc0005072.1_g000009 Rmu_sc0024469.1_g000004
rosa_roxburghii	Rroxscaffold_2G00121510
rosa_rugosa	Rorug05G0102500 Rorug07G0132700
rosa_samantha	Rh1AG344800 Rh1BG170200 Rh1CG262000 Rh2AG051400 Rh2BG245700 Rh2DG331100 Rh3BG137600 Rh3DG139000 Rh3DG303000 Rh5AG377200 Rh5BG534400 Rh6AG001100 Rh7AG343400 Rh7BG401400 Rh7CG360900 Rh7CG470900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	2 cut(s)	8, 131
Acc36I	ACCTGC	2 cut(s)	8, 131
AccI	GTMKAC	1 cut(s)	6
AclWI	GGATC	1 cut(s)	117
AcyI	GRCGYC	1 cut(s)	174
AjiI	CACGTC	4 cut(s)	43, 124, 166, 247
AjnI	CCWGG	2 cut(s)	75, 198
AluBI	AGCT	1 cut(s)	255
AluI	AGCT	1 cut(s)	255
Alw26I	GTCTC	1 cut(s)	21
AlwI	GGATC	1 cut(s)	117
AspLEI	GCGC	2 cut(s)	119, 242
AspS9I	GGNCC	2 cut(s)	73, 196
AvaII	GGWCC	2 cut(s)	73, 196
BciT130I	CCWGG	2 cut(s)	77, 200
BcoDI	GTCTC	1 cut(s)	21
BfaI	CTAG	1 cut(s)	256
BfoI	RGCGCY	2 cut(s)	120, 243
BfuAI	ACCTGC	2 cut(s)	8, 131
BglII	AGATCT	1 cut(s)	232
Bme1390I	CCNGG	2 cut(s)	77, 200
Bme18I	GGWCC	2 cut(s)	73, 196
BmgBI	CACGTC	4 cut(s)	43, 124, 166, 247
BmgT120I	GGNCC	2 cut(s)	73, 196
BmrFI	CCNGG	2 cut(s)	77, 200
BpmI	CTGGAG	2 cut(s)	110, 233
BsaHI	GRCGYC	1 cut(s)	174
BsaJI	CCNNGG	2 cut(s)	76, 199
BseBI	CCWGG	2 cut(s)	77, 200
BseDI	CCNNGG	2 cut(s)	76, 199
BseRI	GAGGAG	2 cut(s)	39, 162
BsmAI	GTCTC	1 cut(s)	21
BsmBI	CGTCTC	1 cut(s)	21
Bsp143I	GATC	2 cut(s)	109, 232
BspMI	ACCTGC	2 cut(s)	8, 131
BspPI	GGATC	1 cut(s)	117
BssECI	CCNNGG	2 cut(s)	76, 199
BssMI	GATC	2 cut(s)	109, 232
BssNI	GRCGYC	1 cut(s)	174
Bst2UI	CCWGG	2 cut(s)	77, 200
BstACI	GRCGYC	1 cut(s)	174
BstH2I	RGCGCY	2 cut(s)	120, 243
BstHHI	GCGC	2 cut(s)	119, 242
BstKTI	GATC	2 cut(s)	112, 235
BstMAI	GTCTC	1 cut(s)	21
BstMBI	GATC	2 cut(s)	109, 232
BstNI	CCWGG	2 cut(s)	77, 200
BstSCI	CCNGG	2 cut(s)	75, 198
BstX2I	RGATCY	2 cut(s)	109, 232
BstYI	RGATCY	2 cut(s)	109, 232
BtrI	CACGTC	4 cut(s)	43, 124, 166, 247
BveI	ACCTGC	2 cut(s)	8, 131
CfoI	GCGC	2 cut(s)	119, 242
Cfr13I	GGNCC	2 cut(s)	73, 196
CseI	GACGC	2 cut(s)	40, 163
CviJI	RGCY	1 cut(s)	255
CviKI_1	RGCY	1 cut(s)	255
DpnI	GATC	2 cut(s)	111, 234
DpnII	GATC	2 cut(s)	109, 232
Eco47I	GGWCC	2 cut(s)	73, 196
EcoO109I	RGGNCCY	2 cut(s)	73, 196
EcoRII	CCWGG	2 cut(s)	75, 198
Esp3I	CGTCTC	1 cut(s)	21
FblI	GTMKAC	1 cut(s)	6
FspBI	CTAG	1 cut(s)	256
GlaI	GCGC	2 cut(s)	118, 241
GsuI	CTGGAG	2 cut(s)	110, 233
HaeII	RGCGCY	2 cut(s)	120, 243
HgaI	GACGC	2 cut(s)	40, 163
HhaI	GCGC	2 cut(s)	119, 242
Hin1I	GRCGYC	1 cut(s)	174
Hin6I	GCGC	2 cut(s)	117, 240
HinP1I	GCGC	2 cut(s)	117, 240
HincII	GTYRAC	1 cut(s)	7
HindII	GTYRAC	1 cut(s)	7
Hpy166II	GTNNAC	1 cut(s)	7
Hpy188I	TCNGA	2 cut(s)	56, 179
Hpy188III	TCNNGA	2 cut(s)	89, 212
Hpy8I	GTNNAC	1 cut(s)	7
Hpy99I	CGWCG	3 cut(s)	11, 56, 179
HpyCH4IV	ACGT	5 cut(s)	30, 42, 123, 165, 246
HpyCH4V	TGCA	1 cut(s)	140
HpySE526I	ACGT	5 cut(s)	30, 42, 123, 165, 246
Hsp92I	GRCGYC	1 cut(s)	174
HspAI	GCGC	2 cut(s)	117, 240
Kzo9I	GATC	2 cut(s)	109, 232
LpnPI	CCDG	8 cut(s)	3, 62, 74, 89, 126, 185, 197, 212
MaeI	CTAG	1 cut(s)	256
MaeII	ACGT	5 cut(s)	30, 42, 123, 165, 246
MalI	GATC	2 cut(s)	111, 234
MboI	GATC	2 cut(s)	109, 232
MflI	RGATCY	2 cut(s)	109, 232
MluCI	AATT	2 cut(s)	57, 180
MmeI	TCCRAC	4 cut(s)	13, 34, 136, 157
MspR9I	CCNGG	2 cut(s)	77, 200
MvaI	CCWGG	2 cut(s)	77, 200
NdeII	GATC	2 cut(s)	109, 232
PaqCI	CACCTGC	2 cut(s)	8, 131
PcsI	WCGNNNNNNNCGW	5 cut(s)	48, 60, 129, 171, 183
PflFI	GACNNNGTC	7 cut(s)	11, 44, 65, 125, 167, 188, 248
PpuMI	RGGWCCY	2 cut(s)	73, 196
Psp5II	RGGWCCY	2 cut(s)	73, 196
Psp6I	CCWGG	2 cut(s)	75, 198
PspGI	CCWGG	2 cut(s)	75, 198
PspPI	GGNCC	2 cut(s)	73, 196
PspPPI	RGGWCCY	2 cut(s)	73, 196
PsuI	RGATCY	2 cut(s)	109, 232
PsyI	GACNNNGTC	7 cut(s)	11, 44, 65, 125, 167, 188, 248
SalI	GTCGAC	1 cut(s)	5
Sau3AI	GATC	2 cut(s)	109, 232
Sau96I	GGNCC	2 cut(s)	73, 196
ScrFI	CCNGG	2 cut(s)	77, 200
SinI	GGWCC	2 cut(s)	73, 196
Sse9I	AATT	2 cut(s)	57, 180
SspMI	CTAG	1 cut(s)	256
StyD4I	CCNGG	2 cut(s)	75, 198
TaiI	ACGT	5 cut(s)	33, 45, 126, 168, 249
TaqI	TCGA	3 cut(s)	6, 69, 192
TasI	AATT	2 cut(s)	57, 180
Tth111I	GACNNNGTC	7 cut(s)	11, 44, 65, 125, 167, 188, 248
VpaK11BI	GGWCC	2 cut(s)	73, 196
XmiI	GTMKAC	1 cut(s)	6
XspI	CTAG	1 cut(s)	256

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.