Rh7CG360900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
44791953 .. 44792189
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG360900.1

Sequence Viewer

Length: 237 bp
ATGGTCGGCGAGGTCGCAGGTGGAGGAGACGTTGGAGAGGACGTGATCGGCGTCGGAATTGATGATGTCGAGGACCTGGGAGGATTTCTGAAGATTGGAGAGGTCGCGGATCTTGGCGCTGACGTGGTCGGGGAGGTCGCAGGTGGAAGAGACGTTGGAGAGGACGTGGTCGACGTCGGACTTGACGATGTCGAGGACCTGGGAGGATTTTTGGAGATTGGAGAGGTGCTTGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

7.68

Weight (kDa)

4.05

Isoelectric Point (pI)

9.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 8, 131
AatII GACGTC 1 cut(s) 177
Acc36I ACCTGC 2 cut(s) 8, 131
AccI GTMKAC 1 cut(s) 171
AccII CGCG 1 cut(s) 107
AciI CCGC 1 cut(s) 107
AclWI GGATC 1 cut(s) 117
AcuI CTGAAG 1 cut(s) 110
AcyI GRCGYC 2 cut(s) 51, 174
AjiI CACGTC 3 cut(s) 43, 124, 166
AjnI CCWGG 2 cut(s) 75, 198
Alw26I GTCTC 2 cut(s) 21, 144
AlwI GGATC 1 cut(s) 117
AspLEI GCGC 1 cut(s) 119
AspS9I GGNCC 2 cut(s) 73, 196
AvaII GGWCC 2 cut(s) 73, 196
BciT130I CCWGG 2 cut(s) 77, 200
BcoDI GTCTC 2 cut(s) 21, 144
BfaI CTAG 1 cut(s) 235
BfoI RGCGCY 1 cut(s) 120
BfuAI ACCTGC 2 cut(s) 8, 131
Bme1390I CCNGG 2 cut(s) 77, 200
Bme18I GGWCC 2 cut(s) 73, 196
BmgBI CACGTC 3 cut(s) 43, 124, 166
BmgT120I GGNCC 2 cut(s) 73, 196
BmrFI CCNGG 2 cut(s) 77, 200
BsaHI GRCGYC 2 cut(s) 51, 174
BsaJI CCNNGG 2 cut(s) 76, 199
BsaXI ACNNNNNCTCC 6 cut(s) 15, 27, 45, 57, 150, 180
BseBI CCWGG 2 cut(s) 77, 200
BseDI CCNNGG 2 cut(s) 76, 199
BseRI GAGGAG 1 cut(s) 39
Bsh1236I CGCG 1 cut(s) 107
BsmAI GTCTC 2 cut(s) 21, 144
BsmBI CGTCTC 2 cut(s) 21, 144
Bsp143I GATC 2 cut(s) 45, 109
BspACI CCGC 1 cut(s) 107
BspFNI CGCG 1 cut(s) 107
BspMI ACCTGC 2 cut(s) 8, 131
BspPI GGATC 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 76, 199
BssMI GATC 2 cut(s) 45, 109
BssNI GRCGYC 2 cut(s) 51, 174
Bst2UI CCWGG 2 cut(s) 77, 200
Bst6I CTCTTC 1 cut(s) 142
BstACI GRCGYC 2 cut(s) 51, 174
BstFNI CGCG 1 cut(s) 107
BstH2I RGCGCY 1 cut(s) 120
BstHHI GCGC 1 cut(s) 119
BstKTI GATC 2 cut(s) 48, 112
BstMAI GTCTC 2 cut(s) 21, 144
BstMBI GATC 2 cut(s) 45, 109
BstNI CCWGG 2 cut(s) 77, 200
BstSCI CCNGG 2 cut(s) 75, 198
BstUI CGCG 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
BtrI CACGTC 3 cut(s) 43, 124, 166
BveI ACCTGC 2 cut(s) 8, 131
CfoI GCGC 1 cut(s) 119
Cfr13I GGNCC 2 cut(s) 73, 196
CseI GACGC 1 cut(s) 40
DpnI GATC 2 cut(s) 47, 111
DpnII GATC 2 cut(s) 45, 109
Eam1104I CTCTTC 1 cut(s) 142
EarI CTCTTC 1 cut(s) 142
Eco47I GGWCC 2 cut(s) 73, 196
Eco57I CTGAAG 1 cut(s) 110
EcoO109I RGGNCCY 2 cut(s) 73, 196
EcoRII CCWGG 2 cut(s) 75, 198
Esp3I CGTCTC 2 cut(s) 21, 144
FblI GTMKAC 1 cut(s) 171
FspBI CTAG 1 cut(s) 235
GlaI GCGC 1 cut(s) 118
HaeII RGCGCY 1 cut(s) 120
HgaI GACGC 1 cut(s) 40
HhaI GCGC 1 cut(s) 119
Hin1I GRCGYC 2 cut(s) 51, 174
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 3 cut(s) 56, 90, 179
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 3 cut(s) 56, 176, 179
HpyCH4IV ACGT 6 cut(s) 30, 42, 123, 153, 165, 174
HpySE526I ACGT 6 cut(s) 30, 42, 123, 153, 165, 174
Hsp92I GRCGYC 2 cut(s) 51, 174
HspAI GCGC 1 cut(s) 117
Kzo9I GATC 2 cut(s) 45, 109
LpnPI CCDG 6 cut(s) 3, 62, 89, 126, 185, 212
MaeI CTAG 1 cut(s) 235
MaeII ACGT 6 cut(s) 30, 42, 123, 153, 165, 174
MalI GATC 2 cut(s) 47, 111
MboI GATC 2 cut(s) 45, 109
MboII GAAGA 2 cut(s) 103, 159
MflI RGATCY 1 cut(s) 109
MluCI AATT 1 cut(s) 57
MmeI TCCRAC 4 cut(s) 13, 34, 136, 157
MspR9I CCNGG 2 cut(s) 77, 200
MvaI CCWGG 2 cut(s) 77, 200
MvnI CGCG 1 cut(s) 107
NdeII GATC 2 cut(s) 45, 109
PaqCI CACCTGC 2 cut(s) 8, 131
PcsI WCGNNNNNNNCGW 3 cut(s) 48, 171, 183
PflFI GACNNNGTC 3 cut(s) 125, 167, 188
PpuMI RGGWCCY 2 cut(s) 73, 196
Psp5II RGGWCCY 2 cut(s) 73, 196
Psp6I CCWGG 2 cut(s) 75, 198
PspGI CCWGG 2 cut(s) 75, 198
PspPI GGNCC 2 cut(s) 73, 196
PspPPI RGGWCCY 2 cut(s) 73, 196
PsuI RGATCY 1 cut(s) 109
PsyI GACNNNGTC 3 cut(s) 125, 167, 188
SalI GTCGAC 1 cut(s) 170
Sau3AI GATC 2 cut(s) 45, 109
Sau96I GGNCC 2 cut(s) 73, 196
ScrFI CCNGG 2 cut(s) 77, 200
SinI GGWCC 2 cut(s) 73, 196
Sse9I AATT 1 cut(s) 57
SsiI CCGC 1 cut(s) 107
SspMI CTAG 1 cut(s) 235
StyD4I CCNGG 2 cut(s) 75, 198
TaiI ACGT 6 cut(s) 33, 45, 126, 156, 168, 177
TaqI TCGA 3 cut(s) 69, 171, 192
TasI AATT 1 cut(s) 57
Tth111I GACNNNGTC 3 cut(s) 125, 167, 188
VpaK11BI GGWCC 2 cut(s) 73, 196
XmiI GTMKAC 1 cut(s) 171
XspI CTAG 1 cut(s) 235
ZraI GACGTC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.