Rh1CG219500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0005147
Physical Location & Seq
Forward (+)
47019169 .. 47027607
8439 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG219500.1

Sequence Viewer

Length: 219 bp
ATGAGGCTTCTTCTCCGGCAACGACGACAAGGCCTGCGACCTCTTCATCTCGAATCGAAATCCCTAACCAGTGGCTTTCTCTTCACATTCGATCTCAACCACCACCAGCAACGCAAAATCGAAAGTCTAGTCCTTTGCTTTGTACCAGAAGATTGCAGCAAGGAGGAGATACTAAGTAATCAAAAGGATGCAAGCAAGGAATCCGCCCTATTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.4

Weight (kDa)

7.85

Isoelectric Point (pI)

65.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 204
AfaI GTAC 1 cut(s) 144
AoxI GGCC 1 cut(s) 31
ApeKI GCWGC 1 cut(s) 156
ArsI GACNNNNNNTTYG 2 cut(s) 114, 146
BbvI GCAGC 1 cut(s) 168
BfaI CTAG 1 cut(s) 128
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
BmsI GCATC 1 cut(s) 178
Bse1I ACTGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 179
BseXI GCAGC 1 cut(s) 168
BshFI GGCC 1 cut(s) 33
BsiSI CCGG 1 cut(s) 16
BsnI GGCC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 91
BspACI CCGC 1 cut(s) 204
BspANI GGCC 1 cut(s) 33
BsrI ACTGG 1 cut(s) 69
BssMI GATC 1 cut(s) 91
Bst6I CTCTTC 2 cut(s) 48, 86
BstC8I GCNNGC 2 cut(s) 35, 193
BstDEI CTNAG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 168
BsuRI GGCC 1 cut(s) 33
BtsCI GGATG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 76
Cac8I GCNNGC 2 cut(s) 35, 193
Csp6I GTAC 1 cut(s) 143
CviJI RGCY 3 cut(s) 7, 33, 75
CviKI_1 RGCY 3 cut(s) 7, 33, 75
CviQI GTAC 1 cut(s) 143
DdeI CTNAG 1 cut(s) 173
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eam1104I CTCTTC 2 cut(s) 48, 86
EarI CTCTTC 2 cut(s) 48, 86
EciI GGCGGA 1 cut(s) 193
Eco147I AGGCCT 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 157
FokI GGATG 1 cut(s) 200
Fsp4HI GCNGC 1 cut(s) 157
FspBI CTAG 1 cut(s) 128
GluI GCNGC 1 cut(s) 157
HaeIII GGCC 1 cut(s) 33
HapII CCGG 1 cut(s) 16
HinfI GANTC 2 cut(s) 53, 200
HpaII CCGG 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 50
Hpy99I CGWCG 1 cut(s) 27
HpyCH4V TGCA 2 cut(s) 156, 191
HpyF3I CTNAG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 5 cut(s) 29, 47, 82, 119, 159
Lsp1109I GCAGC 1 cut(s) 168
LweI GCATC 1 cut(s) 178
MaeI CTAG 1 cut(s) 128
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 3 cut(s) 35, 73, 161
MnlI CCTC 2 cut(s) 51, 157
MseI TTAA 1 cut(s) 217
MspI CCGG 1 cut(s) 16
NdeII GATC 1 cut(s) 91
PceI AGGCCT 1 cut(s) 33
PfeI GAWTC 2 cut(s) 53, 200
PkrI GCNGC 1 cut(s) 158
RsaI GTAC 1 cut(s) 144
RsaNI GTAC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 217
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 91
SetI ASST 1 cut(s) 43
SfaNI GCATC 1 cut(s) 178
SseBI AGGCCT 1 cut(s) 33
SsiI CCGC 1 cut(s) 204
SspMI CTAG 1 cut(s) 128
StuI AGGCCT 1 cut(s) 33
TaqI TCGA 4 cut(s) 51, 56, 90, 120
TfiI GAWTC 2 cut(s) 53, 200
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TscAI CASTG 1 cut(s) 76
TseI GCWGC 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 35
TspRI CASTG 1 cut(s) 76
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.