Rh7AG445600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0005147
Physical Location & Seq
Reverse (-)
60524863 .. 60525114
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG445600.1

Sequence Viewer

Length: 252 bp
ATGTTGAGATCCAAGCTCAACCTCAACGGGGTGTCTTTTGTTCTGGAAAATGAGCTTGATCAGGTTCCTGTTGTACTTCTTGGCATTGTCTGGCATGGCTCCGGCCTCGTCCTCGTGGCCTTTGGAAGGCCAGCCGGTCACGGAGATGTGAACCGGAAGCTTCTTGTAGCCGAAGGATCCAAGGGAGGTGTAGACGGCGTCGATATGGGCGAAGAACATGTTATCATAGTGGAGATTGGGGGCCAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.73

Weight (kDa)

5.13

Isoelectric Point (pI)

22.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 192
AclWI GGATC 3 cut(s) 3, 171, 184
AcyI GRCGYC 1 cut(s) 198
AfaI GTAC 1 cut(s) 75
AfiI CCNNNNNNNGG 2 cut(s) 28, 126
AflIII ACRYGT 1 cut(s) 217
AluBI AGCT 3 cut(s) 16, 55, 160
AluI AGCT 3 cut(s) 16, 55, 160
AlwI GGATC 3 cut(s) 3, 171, 184
AoxI GGCC 4 cut(s) 103, 117, 128, 241
AspS9I GGNCC 1 cut(s) 241
BamHI GGATCC 1 cut(s) 176
BauI CACGAG 1 cut(s) 113
BceAI ACGGC 1 cut(s) 211
BclI TGATCA 1 cut(s) 58
BfaI CTAG 1 cut(s) 250
BglII AGATCT 1 cut(s) 246
BmgT120I GGNCC 1 cut(s) 241
BmiI GGNNCC 4 cut(s) 66, 100, 178, 242
BsaHI GRCGYC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 180
BsaWI WCCGGW 1 cut(s) 153
Bsc4I CCNNNNNNNGG 2 cut(s) 28, 126
Bse118I RCCGGY 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 2 cut(s) 28, 126
BshFI GGCC 4 cut(s) 105, 119, 130, 243
BsiSI CCGG 3 cut(s) 102, 135, 154
BslI CCNNNNNNNGG 2 cut(s) 28, 126
BsnI GGCC 4 cut(s) 105, 119, 130, 243
Bsp143I GATC 4 cut(s) 8, 58, 176, 246
BspANI GGCC 4 cut(s) 105, 119, 130, 243
BspLI GGNNCC 4 cut(s) 66, 100, 178, 242
BspPI GGATC 3 cut(s) 3, 171, 184
BsrFI RCCGGY 1 cut(s) 134
BssAI RCCGGY 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 4 cut(s) 8, 58, 176, 246
BssNI GRCGYC 1 cut(s) 198
BssSI CACGAG 1 cut(s) 113
BssT1I CCWWGG 1 cut(s) 180
Bst2BI CACGAG 1 cut(s) 113
BstACI GRCGYC 1 cut(s) 198
BstC8I GCNNGC 1 cut(s) 132
BstENI CCTNNNNNAGG 1 cut(s) 124
BstKTI GATC 4 cut(s) 11, 61, 179, 249
BstMBI GATC 4 cut(s) 8, 58, 176, 246
BstNSI RCATGY 1 cut(s) 221
BstX2I RGATCY 3 cut(s) 8, 176, 246
BstYI RGATCY 3 cut(s) 8, 176, 246
BsuRI GGCC 4 cut(s) 105, 119, 130, 243
Cac8I GCNNGC 1 cut(s) 132
Cfr10I RCCGGY 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 241
CseI GACGC 1 cut(s) 187
Csp6I GTAC 1 cut(s) 74
CviAII CATG 2 cut(s) 95, 218
CviQI GTAC 1 cut(s) 74
DpnI GATC 4 cut(s) 10, 60, 178, 248
DpnII GATC 4 cut(s) 8, 58, 176, 246
Eco130I CCWWGG 1 cut(s) 180
EcoNI CCTNNNNNAGG 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 2 cut(s) 98, 221
FaiI YATR 4 cut(s) 96, 206, 219, 227
FatI CATG 2 cut(s) 94, 217
FbaI TGATCA 1 cut(s) 58
FblI GTMKAC 1 cut(s) 192
FspBI CTAG 1 cut(s) 250
HaeIII GGCC 4 cut(s) 105, 119, 130, 243
HapII CCGG 3 cut(s) 102, 135, 154
HgaI GACGC 1 cut(s) 187
Hin1I GRCGYC 1 cut(s) 198
Hin1II CATG 2 cut(s) 98, 221
HindIII AAGCTT 1 cut(s) 158
HpaII CCGG 3 cut(s) 102, 135, 154
Hpy166II GTNNAC 2 cut(s) 151, 193
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 2 cut(s) 151, 193
Hpy99I CGWCG 1 cut(s) 203
HpyAV CCTTC 2 cut(s) 120, 167
Hsp92I GRCGYC 1 cut(s) 198
Hsp92II CATG 2 cut(s) 98, 221
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 4 cut(s) 8, 58, 176, 246
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 8 cut(s) 29, 47, 76, 81, 115, 144, 148, 167
MaeI CTAG 1 cut(s) 250
MaeIII GTNAC 1 cut(s) 137
MalI GATC 4 cut(s) 10, 60, 178, 248
MboI GATC 4 cut(s) 8, 58, 176, 246
MboII GAAGA 1 cut(s) 224
MflI RGATCY 3 cut(s) 8, 176, 246
MnlI CCTC 4 cut(s) 32, 116, 122, 179
MslI CAYNNNNRTG 1 cut(s) 144
MspI CCGG 3 cut(s) 102, 135, 154
NdeII GATC 4 cut(s) 8, 58, 176, 246
NlaIII CATG 2 cut(s) 98, 221
NlaIV GGNNCC 4 cut(s) 66, 100, 178, 242
NmuCI GTSAC 1 cut(s) 137
NspI RCATGY 1 cut(s) 221
PciI ACATGT 1 cut(s) 217
PcsI WCGNNNNNNNCGW 1 cut(s) 207
PflFI GACNNNGTC 1 cut(s) 197
PscI ACATGT 1 cut(s) 217
PspN4I GGNNCC 4 cut(s) 66, 100, 178, 242
PspPI GGNCC 1 cut(s) 241
PsuI RGATCY 3 cut(s) 8, 176, 246
PsyI GACNNNGTC 1 cut(s) 197
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
RseI CAYNNNNRTG 1 cut(s) 144
Sau3AI GATC 4 cut(s) 8, 58, 176, 246
Sau96I GGNCC 1 cut(s) 241
SetI ASST 6 cut(s) 18, 24, 57, 66, 162, 190
SmiMI CAYNNNNRTG 1 cut(s) 144
SspMI CTAG 1 cut(s) 250
StyI CCWWGG 1 cut(s) 180
TaqI TCGA 1 cut(s) 201
TatI WGTACW 1 cut(s) 73
TseFI GTSAC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 137
TspGWI ACGGA 1 cut(s) 156
Tth111I GACNNNGTC 1 cut(s) 197
XagI CCTNNNNNAGG 1 cut(s) 124
XceI RCATGY 1 cut(s) 221
XmiI GTMKAC 1 cut(s) 192
XspI CTAG 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.