Rh2AG090000

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
7535156 .. 7535506
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG090000.1

Sequence Viewer

Length: 351 bp
ATGGCTTTAGTACCAAAATTGTCATCTGATGCACTCTTTGAGATTCTAACAAGATCATCCTTAGAAACTGTAGGGAGTTGCAGATCGATTTCAAAGGAGTGGAATCGAGTCACATACGAATCAAGCTTCCATCAACTACTTTGCGAGAGAACTAACATAGTTTCTGGATTTTTCATTCAAAGCCTAGTTGACTCCCAACACTCATCCGCGTTTGTGTCGCTGGATAATAATGTCAACTTCACTTCGGCACTGTCATTGGATTTTTTAAACATTCCTGTCCGAATTGAAGCTGTGAATCAAGGTCTACGTACTCGTGTGTGTCAACCAGAACAAGAGATATTTGGTTTGTAA

Protein Analysis

116

Amino Acids

13.0

Weight (kDa)

5.26

Isoelectric Point (pI)

54.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 304
AccII CGCG 1 cut(s) 209
AciI CCGC 1 cut(s) 207
AfaI GTAC 2 cut(s) 12, 310
AgsI TTSAA 3 cut(s) 93, 179, 287
AluBI AGCT 2 cut(s) 126, 290
AluI AGCT 2 cut(s) 126, 290
BauI CACGAG 1 cut(s) 312
BccI CCATC 1 cut(s) 138
BfaI CTAG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 69
BmsI GCATC 1 cut(s) 19
Bsa29I ATCGAT 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 308
BseCI ATCGAT 1 cut(s) 86
BseGI GGATG 2 cut(s) 56, 203
Bsh1236I CGCG 1 cut(s) 209
BshVI ATCGAT 1 cut(s) 86
Bsp143I GATC 2 cut(s) 53, 83
BspACI CCGC 1 cut(s) 207
BspDI ATCGAT 1 cut(s) 86
BspFNI CGCG 1 cut(s) 209
BssMI GATC 2 cut(s) 53, 83
BssSI CACGAG 1 cut(s) 312
Bst2BI CACGAG 1 cut(s) 312
Bst4CI ACNGT 2 cut(s) 70, 252
BstBAI YACGTR 1 cut(s) 308
BstDEI CTNAG 1 cut(s) 61
BstF5I GGATG 2 cut(s) 56, 203
BstFNI CGCG 1 cut(s) 209
BstKTI GATC 2 cut(s) 56, 86
BstMBI GATC 2 cut(s) 53, 83
BstSFI CTRYAG 1 cut(s) 69
BstSNI TACGTA 1 cut(s) 308
BstUI CGCG 1 cut(s) 209
Bsu15I ATCGAT 1 cut(s) 86
BsuTUI ATCGAT 1 cut(s) 86
BtsCI GGATG 2 cut(s) 56, 203
BtsIMutI CAGTG 1 cut(s) 248
ClaI ATCGAT 1 cut(s) 86
Csp6I GTAC 2 cut(s) 11, 309
CviJI RGCY 4 cut(s) 5, 126, 183, 290
CviKI_1 RGCY 4 cut(s) 5, 126, 183, 290
CviQI GTAC 2 cut(s) 11, 309
DdeI CTNAG 1 cut(s) 61
DpnI GATC 2 cut(s) 55, 85
DpnII GATC 2 cut(s) 53, 83
DraI TTTAAA 1 cut(s) 267
Eco105I TACGTA 1 cut(s) 308
FaiI YATR 2 cut(s) 115, 158
FblI GTMKAC 1 cut(s) 304
FokI GGATG 2 cut(s) 43, 190
FspBI CTAG 1 cut(s) 185
HincII GTYRAC 3 cut(s) 190, 235, 323
HindII GTYRAC 3 cut(s) 190, 235, 323
HindIII AAGCTT 1 cut(s) 124
HinfI GANTC 6 cut(s) 43, 103, 108, 119, 191, 295
Hpy166II GTNNAC 4 cut(s) 190, 235, 305, 323
Hpy188I TCNGA 2 cut(s) 28, 281
Hpy188III TCNNGA 1 cut(s) 165
Hpy8I GTNNAC 4 cut(s) 190, 235, 305, 323
HpyCH4III ACNGT 2 cut(s) 70, 252
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 2 cut(s) 32, 81
HpyF3I CTNAG 1 cut(s) 61
HpySE526I ACGT 1 cut(s) 307
Kzo9I GATC 2 cut(s) 53, 83
LpnPI CCDG 4 cut(s) 150, 206, 288, 339
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 185
MaeII ACGT 1 cut(s) 307
MaeIII GTNAC 1 cut(s) 109
MalI GATC 2 cut(s) 55, 85
MboI GATC 2 cut(s) 53, 83
MluCI AATT 2 cut(s) 17, 282
MlyI GAGTC 2 cut(s) 117, 185
MseI TTAA 1 cut(s) 266
MvnI CGCG 1 cut(s) 209
NdeII GATC 2 cut(s) 53, 83
NmuCI GTSAC 1 cut(s) 109
PfeI GAWTC 4 cut(s) 43, 103, 119, 295
PleI GAGTC 2 cut(s) 116, 185
PpsI GAGTC 2 cut(s) 116, 185
Ppu21I YACGTR 1 cut(s) 308
RsaI GTAC 2 cut(s) 12, 310
RsaNI GTAC 2 cut(s) 11, 309
SaqAI TTAA 1 cut(s) 266
Sau3AI GATC 2 cut(s) 53, 83
SchI GAGTC 2 cut(s) 117, 185
SetI ASST 4 cut(s) 128, 292, 304, 310
SfaNI GCATC 1 cut(s) 19
SfcI CTRYAG 1 cut(s) 69
SnaBI TACGTA 1 cut(s) 308
Sse9I AATT 2 cut(s) 17, 282
SsiI CCGC 1 cut(s) 207
SspMI CTAG 1 cut(s) 185
TaaI ACNGT 2 cut(s) 70, 252
TaiI ACGT 1 cut(s) 310
TaqI TCGA 2 cut(s) 86, 106
TasI AATT 2 cut(s) 17, 282
TfiI GAWTC 4 cut(s) 43, 103, 119, 295
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TscAI CASTG 1 cut(s) 255
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 163
TspRI CASTG 1 cut(s) 255
XmiI GTMKAC 1 cut(s) 304
XspI CTAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.