Rh2BG320400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
38336093 .. 38340469
4377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG320400.1

Sequence Viewer

Length: 210 bp
ATGGAGCTTGAGAGAAACGACGTCGTCTTCGACGGACACAATGTCGACGTTTCCACCATCATTGATGGTCTAGGGGCAGAAGTCCTCGAGAACCAAGTCAATGTTGGGAACTATCAATCACAGCGGCGTCACCACCATATCGATATCGATGTTGATATCATTATCCTTTCACACTTCCCCATAAATCCAATTTCTATTTGTTGGTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.92

Weight (kDa)

4.61

Isoelectric Point (pI)

40.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 24
AccI GTMKAC 1 cut(s) 45
AciI CCGC 1 cut(s) 124
AcyI GRCGYC 2 cut(s) 21, 127
AfaI GTAC 1 cut(s) 206
AhdI GACNNNNNGTC 1 cut(s) 41
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
Ama87I CYCGRG 1 cut(s) 86
ArsI GACNNNNNNTTYG 2 cut(s) 11, 43
AsuHPI GGTGA 1 cut(s) 122
AvaI CYCGRG 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 19
BccI CCATC 2 cut(s) 59, 65
BfaI CTAG 1 cut(s) 71
BisI GCNGC 1 cut(s) 125
BlsI GCNGC 1 cut(s) 126
BmeRI GACNNNNNGTC 1 cut(s) 41
BmeT110I CYCGRG 1 cut(s) 86
BpiI GAAGAC 1 cut(s) 19
BpuEI CTTGAG 1 cut(s) 29
Bsa29I ATCGAT 2 cut(s) 141, 147
BsaHI GRCGYC 2 cut(s) 21, 127
BseCI ATCGAT 2 cut(s) 141, 147
BshVI ATCGAT 2 cut(s) 141, 147
BsiHKCI CYCGRG 1 cut(s) 86
BsoBI CYCGRG 1 cut(s) 86
BspACI CCGC 1 cut(s) 124
BspDI ATCGAT 2 cut(s) 141, 147
BssNI GRCGYC 2 cut(s) 21, 127
BstACI GRCGYC 2 cut(s) 21, 127
BstV2I GAAGAC 1 cut(s) 19
Bsu15I ATCGAT 2 cut(s) 141, 147
BsuTUI ATCGAT 2 cut(s) 141, 147
ClaI ATCGAT 2 cut(s) 141, 147
CseI GACGC 1 cut(s) 116
Csp6I GTAC 1 cut(s) 205
CspCI CAANNNNNGTGG 2 cut(s) 43, 78
CviJI RGCY 1 cut(s) 7
CviKI_1 RGCY 1 cut(s) 7
CviQI GTAC 1 cut(s) 205
DriI GACNNNNNGTC 1 cut(s) 41
Eam1105I GACNNNNNGTC 1 cut(s) 41
Eco32I GATATC 2 cut(s) 145, 157
Eco88I CYCGRG 1 cut(s) 86
EcoRV GATATC 2 cut(s) 145, 157
FaiI YATR 2 cut(s) 138, 182
FblI GTMKAC 1 cut(s) 45
Fnu4HI GCNGC 1 cut(s) 125
Fsp4HI GCNGC 1 cut(s) 125
FspBI CTAG 1 cut(s) 71
GluI GCNGC 1 cut(s) 125
HgaI GACGC 1 cut(s) 116
Hin1I GRCGYC 2 cut(s) 21, 127
HincII GTYRAC 1 cut(s) 46
HindII GTYRAC 1 cut(s) 46
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 46
Hpy99I CGWCG 4 cut(s) 23, 26, 35, 50
HpyCH4IV ACGT 2 cut(s) 21, 48
HpySE526I ACGT 2 cut(s) 21, 48
Hsp92I GRCGYC 2 cut(s) 21, 127
LmnI GCTCC 1 cut(s) 4
MaeI CTAG 1 cut(s) 71
MaeII ACGT 2 cut(s) 21, 48
MaeIII GTNAC 1 cut(s) 128
MboII GAAGA 1 cut(s) 19
MluCI AATT 1 cut(s) 189
MnlI CCTC 1 cut(s) 95
MspA1I CMGCKG 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 128
PaeR7I CTCGAG 1 cut(s) 86
PcsI WCGNNNNNNNCGW 1 cut(s) 27
PflFI GACNNNGTC 1 cut(s) 23
PkrI GCNGC 1 cut(s) 126
PsyI GACNNNGTC 1 cut(s) 23
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SalI GTCGAC 1 cut(s) 44
SatI GCNGC 1 cut(s) 125
SetI ASST 3 cut(s) 9, 24, 51
Sfr274I CTCGAG 1 cut(s) 86
SgeI CNNG 5 cut(s) 20, 83, 98, 100, 107
SlaI CTCGAG 1 cut(s) 86
SmlI CTYRAG 2 cut(s) 8, 86
SmoI CTYRAG 2 cut(s) 8, 86
Sse9I AATT 1 cut(s) 189
SsiI CCGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 71
TaiI ACGT 2 cut(s) 24, 51
TaqI TCGA 5 cut(s) 30, 45, 87, 141, 147
TasI AATT 1 cut(s) 189
TauI GCSGC 1 cut(s) 127
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
TspGWI ACGGA 1 cut(s) 48
Tth111I GACNNNGTC 1 cut(s) 23
XcmI CCANNNNNNNNNTGG 1 cut(s) 101
XhoI CTCGAG 1 cut(s) 86
XmiI GTMKAC 1 cut(s) 45
XspI CTAG 1 cut(s) 71
ZraI GACGTC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.