Rh2DG539500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0001854
Physical Location & Seq
Reverse (-)
76859716 .. 76862703
2988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG539500.1

Sequence Viewer

Length: 348 bp
ATGGTCATTTTATTCAGACCCCTAAAATTAATATATGGACCTCTTATAATATTTGTTACCATTAAATTTTCAGTTATGCCCCATACATTTTTCCTATCTACACCTCCGTCCTTTCTTGCCTTGTATTCTGTAGGCCTTATTTTCTTTGCTGCATTCATGACTTATGTTTGCAGCAATGGTGGTGTGACTGATAAGGAGGCGATCTTGTTTCATTCTACTGGGTCTCAACAGATGGTGTTTACAAAGGCCAACGTTGGTGATGGGGTTGCTGTTTGGATAACAGATCCAGGTCCGTGTGCTATGGGGATGATGGCAACAAGGTCCGACATCGATGTATGCTTAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.55

Weight (kDa)

6.01

Isoelectric Point (pI)

23.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 47
AclI AACGTT 1 cut(s) 252
AclWI GGATC 1 cut(s) 278
AcsI RAATTY 1 cut(s) 65
AjnI CCWGG 1 cut(s) 286
Alw26I GTCTC 1 cut(s) 228
AlwI GGATC 1 cut(s) 278
AoxI GGCC 2 cut(s) 133, 246
ApeKI GCWGC 2 cut(s) 149, 171
ApoI RAATTY 1 cut(s) 65
AseI ATTAAT 1 cut(s) 29
AspS9I GGNCC 3 cut(s) 38, 290, 321
AsuHPI GGTGA 1 cut(s) 269
AvaII GGWCC 3 cut(s) 38, 290, 321
BbvI GCAGC 2 cut(s) 136, 183
BccI CCATC 3 cut(s) 226, 254, 304
BciT130I CCWGG 1 cut(s) 288
BcoDI GTCTC 1 cut(s) 228
BfmI CTRYAG 1 cut(s) 129
BisI GCNGC 2 cut(s) 150, 172
BlsI GCNGC 2 cut(s) 151, 173
Bme1390I CCNGG 1 cut(s) 288
Bme18I GGWCC 3 cut(s) 38, 290, 321
BmgT120I GGNCC 3 cut(s) 38, 290, 321
BmrFI CCNGG 1 cut(s) 288
BmrI ACTGGG 1 cut(s) 228
BmuI ACTGGG 1 cut(s) 228
Bsa29I ATCGAT 1 cut(s) 330
BsaI GGTCTC 1 cut(s) 228
Bse1I ACTGG 1 cut(s) 223
Bse3DI GCAATG 1 cut(s) 181
BseBI CCWGG 1 cut(s) 288
BseCI ATCGAT 1 cut(s) 330
BseGI GGATG 1 cut(s) 312
BseMI GCAATG 1 cut(s) 181
BseNI ACTGG 1 cut(s) 223
BseXI GCAGC 2 cut(s) 136, 183
BshFI GGCC 2 cut(s) 135, 248
BshVI ATCGAT 1 cut(s) 330
BsmAI GTCTC 1 cut(s) 228
BsmI GAATGC 1 cut(s) 152
BsnI GGCC 2 cut(s) 135, 248
Bso31I GGTCTC 1 cut(s) 228
Bsp143I GATC 2 cut(s) 201, 283
BspANI GGCC 2 cut(s) 135, 248
BspDI ATCGAT 1 cut(s) 330
BspHI TCATGA 1 cut(s) 156
BspPI GGATC 1 cut(s) 278
BspTNI GGTCTC 1 cut(s) 228
BsrDI GCAATG 1 cut(s) 181
BsrI ACTGG 1 cut(s) 223
BssMI GATC 2 cut(s) 201, 283
Bst2UI CCWGG 1 cut(s) 288
BstDEI CTNAG 1 cut(s) 340
BstF5I GGATG 1 cut(s) 312
BstKTI GATC 2 cut(s) 204, 286
BstMAI GTCTC 1 cut(s) 228
BstMBI GATC 2 cut(s) 201, 283
BstNI CCWGG 1 cut(s) 288
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 129
BstV1I GCAGC 2 cut(s) 136, 183
BstX2I RGATCY 1 cut(s) 283
BstYI RGATCY 1 cut(s) 283
Bsu15I ATCGAT 1 cut(s) 330
BsuRI GGCC 2 cut(s) 135, 248
BsuTUI ATCGAT 1 cut(s) 330
BtsCI GGATG 1 cut(s) 312
CciI TCATGA 1 cut(s) 156
Cfr13I GGNCC 3 cut(s) 38, 290, 321
ClaI ATCGAT 1 cut(s) 330
CviAII CATG 1 cut(s) 157
CviJI RGCY 2 cut(s) 135, 248
CviKI_1 RGCY 2 cut(s) 135, 248
DdeI CTNAG 1 cut(s) 340
DpnI GATC 2 cut(s) 203, 285
DpnII GATC 2 cut(s) 201, 283
Eco147I AGGCCT 1 cut(s) 135
Eco31I GGTCTC 1 cut(s) 228
Eco47I GGWCC 3 cut(s) 38, 290, 321
EcoRII CCWGG 1 cut(s) 286
FaeI CATG 1 cut(s) 160
FaiI YATR 9 cut(s) 34, 36, 47, 77, 84, 158, 165, 302, 337
FatI CATG 1 cut(s) 156
Fnu4HI GCNGC 2 cut(s) 150, 172
FokI GGATG 1 cut(s) 319
Fsp4HI GCNGC 2 cut(s) 150, 172
GluI GCNGC 2 cut(s) 150, 172
HaeIII GGCC 2 cut(s) 135, 248
Hin1II CATG 1 cut(s) 160
HphI GGTGA 1 cut(s) 269
Hpy166II GTNNAC 1 cut(s) 240
Hpy188I TCNGA 2 cut(s) 17, 325
Hpy188III TCNNGA 1 cut(s) 157
Hpy8I GTNNAC 1 cut(s) 240
HpyCH4IV ACGT 1 cut(s) 252
HpyCH4V TGCA 2 cut(s) 152, 171
HpyF3I CTNAG 1 cut(s) 340
HpySE526I ACGT 1 cut(s) 252
Hsp92II CATG 1 cut(s) 160
Kzo9I GATC 2 cut(s) 201, 283
LpnPI CCDG 3 cut(s) 204, 273, 300
Lsp1109I GCAGC 2 cut(s) 136, 183
MaeII ACGT 1 cut(s) 252
MaeIII GTNAC 2 cut(s) 55, 184
MalI GATC 2 cut(s) 203, 285
MboI GATC 2 cut(s) 201, 283
MflI RGATCY 1 cut(s) 283
MluCI AATT 2 cut(s) 26, 65
MmeI TCCRAC 1 cut(s) 348
MnlI CCTC 3 cut(s) 51, 114, 190
MseI TTAA 2 cut(s) 29, 63
MspR9I CCNGG 1 cut(s) 288
Mva1269I GAATGC 1 cut(s) 152
MvaI CCWGG 1 cut(s) 288
NdeII GATC 2 cut(s) 201, 283
NlaIII CATG 1 cut(s) 160
NmuCI GTSAC 1 cut(s) 184
PagI TCATGA 1 cut(s) 156
PceI AGGCCT 1 cut(s) 135
PctI GAATGC 1 cut(s) 152
PkrI GCNGC 2 cut(s) 151, 173
PshBI ATTAAT 1 cut(s) 29
PsiI TTATAA 1 cut(s) 47
Psp1406I AACGTT 1 cut(s) 252
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
PspPI GGNCC 3 cut(s) 38, 290, 321
PsuI RGATCY 1 cut(s) 283
SaqAI TTAA 2 cut(s) 29, 63
SatI GCNGC 2 cut(s) 150, 172
Sau3AI GATC 2 cut(s) 201, 283
Sau96I GGNCC 3 cut(s) 38, 290, 321
ScrFI CCNGG 1 cut(s) 288
SetI ASST 5 cut(s) 43, 106, 255, 292, 323
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 9 cut(s) 128, 133, 169, 217, 231, 299, 300, 306, 330
SinI GGWCC 3 cut(s) 38, 290, 321
Sse9I AATT 2 cut(s) 26, 65
SseBI AGGCCT 1 cut(s) 135
SspI AATATT 1 cut(s) 51
StuI AGGCCT 1 cut(s) 135
StyD4I CCNGG 1 cut(s) 286
TaiI ACGT 1 cut(s) 255
TaqI TCGA 1 cut(s) 330
TasI AATT 2 cut(s) 26, 65
Tru1I TTAA 2 cut(s) 29, 63
Tru9I TTAA 2 cut(s) 29, 63
TseFI GTSAC 1 cut(s) 184
TseI GCWGC 2 cut(s) 149, 171
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 2 cut(s) 145, 200
TspGWI ACGGA 2 cut(s) 96, 282
VpaK11BI GGWCC 3 cut(s) 38, 290, 321
VspI ATTAAT 1 cut(s) 29
XapI RAATTY 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.