Rh3BG204900

UPF0481 protein At3g47200-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
18338691 .. 18351347
12657 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG204900.1

Sequence Viewer

Length: 267 bp
ATGAGCTCTCTCATCAATACCCCTAGAGACGTCGCATTGCTTTCTGGTAACGGGATTATCATTACCAGCTTCTCACACAACGACCATAGCATAGCTGACCTGTTGAACAAGTTAGGGAAAACAGTTTATTTCGACAAGGATTGCTACCTCTCCAAGCAATTCAGAGACGTGGAGGCTTATTACAACAGCCATTGGGCATGGAAAGCTTATTTCTCTTTTGAAAGTCCATCCAATCCTAAAGCAACTTTACCTAAAGCTGGTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.94

Weight (kDa)

7.89

Isoelectric Point (pI)

26.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 1 - 81 1.4e-15 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 33
AcyI GRCGYC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 257
AgsI TTSAA 2 cut(s) 106, 221
AjiI CACGTC 1 cut(s) 169
AluBI AGCT 5 cut(s) 6, 69, 95, 206, 257
AluI AGCT 5 cut(s) 6, 69, 95, 206, 257
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 2 cut(s) 21, 159
BanII GRGCYC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 235
BcoDI GTCTC 2 cut(s) 21, 159
BfaI CTAG 2 cut(s) 24, 265
BmgBI CACGTC 1 cut(s) 169
BsaHI GRCGYC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 257
Bse3DI GCAATG 1 cut(s) 35
BseGI GGATG 1 cut(s) 227
BseLI CCNNNNNNNGG 1 cut(s) 257
BseMI GCAATG 1 cut(s) 35
BsiHKAI GWGCWC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 257
BsmAI GTCTC 2 cut(s) 21, 159
BsmBI CGTCTC 2 cut(s) 21, 159
Bsp1286I GDGCHC 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 35
BssNI GRCGYC 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 124
BstACI GRCGYC 1 cut(s) 30
BstF5I GGATG 1 cut(s) 227
BstMAI GTCTC 2 cut(s) 21, 159
BstMWI GCNNNNNNNGC 1 cut(s) 203
BtrI CACGTC 1 cut(s) 169
BtsCI GGATG 1 cut(s) 227
CviAII CATG 1 cut(s) 198
CviJI RGCY 7 cut(s) 6, 69, 95, 176, 189, 206, 257
CviKI_1 RGCY 7 cut(s) 6, 69, 95, 176, 189, 206, 257
Ecl136II GAGCTC 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 8
Eco53kI GAGCTC 1 cut(s) 6
EcoICRI GAGCTC 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 8
Esp3I CGTCTC 2 cut(s) 21, 159
FaeI CATG 1 cut(s) 201
FaiI YATR 3 cut(s) 87, 92, 199
FatI CATG 1 cut(s) 197
FokI GGATG 1 cut(s) 214
FriOI GRGCYC 1 cut(s) 8
FspBI CTAG 2 cut(s) 24, 265
Hin1I GRCGYC 1 cut(s) 30
Hin1II CATG 1 cut(s) 201
HindIII AAGCTT 1 cut(s) 204
Hpy188I TCNGA 1 cut(s) 164
Hpy99I CGWCG 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4IV ACGT 2 cut(s) 30, 168
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpySE526I ACGT 2 cut(s) 30, 168
Hsp92I GRCGYC 1 cut(s) 30
Hsp92II CATG 1 cut(s) 201
LpnPI CCDG 4 cut(s) 30, 79, 113, 243
MaeI CTAG 2 cut(s) 24, 265
MaeII ACGT 2 cut(s) 30, 168
MaeIII GTNAC 2 cut(s) 47, 260
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 158
MnlI CCTC 2 cut(s) 158, 166
MwoI GCNNNNNNNGC 1 cut(s) 203
NlaIII CATG 1 cut(s) 201
NmuCI GTSAC 1 cut(s) 260
Psp124BI GAGCTC 1 cut(s) 8
SacI GAGCTC 1 cut(s) 8
SduI GDGCHC 1 cut(s) 8
Sse9I AATT 1 cut(s) 158
SspMI CTAG 2 cut(s) 24, 265
SstI GAGCTC 1 cut(s) 8
TaaI ACNGT 1 cut(s) 124
TaiI ACGT 2 cut(s) 33, 171
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 158
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
XspI CTAG 2 cut(s) 24, 265
ZraI GACGTC 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.