Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3B

Orthogroup ID

OG0002694

Physical Location & Seq

Genomic Coordinates Forward (+)

18354122 .. 18366773

Gene Structure 12652 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3BG205100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGAGCTCTCTCATCAATACCCCTAGAGACGTCGCATTGCTTTCTGGTAACGGGATTATCATTACCAGCTTCTCACACAACGACCATAGCATAGCTGACCTGTTGAACAAGTTAGGGAAAACAGTTTATTTCGACAAGGATTGCTACCTCTCCAAGCAATTCAGAGACGTGGAGGCTTATTACAACAGCCATTGGGCATGGAAAGCTTATTTCTCTTTTGAAAGTCCATCCAATCCTAAAGCAACTTTACCTAAAGCTGGTCACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF247

Protein Analysis

88

Amino Acids

9.94

Weight (kDa)

7.89

Isoelectric Point (pI)

26.11

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF247	PF03140	1 - 81	1.4e-15	Plant protein of unknown function

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002694)

Species	Orthologous Gene IDs
malus_domestica	MD14G1018900.v1.1 MD14G1024400.v1.1
prunus_persica	Prupe.7G114600_v2.0.a1
pyrus_communis	pycom12g02510 pycom12g02520 pycom14g01800 pycom14g02370
rosa_chinensis	RchiOBHm_Chr3g0472561 RchiOBHm_Chr3g0472611 RchiOBHm_Chr3g0472621 RchiOBHm_Chr3g0472631
rosa_laevigata	RLG00000024068 RLG00000036091
rosa_multiflora	Rmu_sc0003510.1_g000022 Rmu_sc0011581.1_g000009
rosa_roxburghii	Rroxscaffold_4G00329230 Rroxscaffold_6G00408790 Rroxscaffold_6G00408840
rosa_rugosa	Rorug03G0198200
rosa_samantha	Rh3AG178500 Rh3AG178900 Rh3AG179000 Rh3AG179100 Rh3AG179200 Rh3AG179300 Rh3AG179400 Rh3BG204300 Rh3BG204800 Rh3BG204900 Rh3BG205000 Rh3BG205100 Rh3BG205200 Rh3BG205300 Rh3CG194800 Rh3CG201800 Rh3CG202200 Rh3CG202300 Rh3CG202400 Rh3DG170600
rosa_wichuraiana	Rw3G016330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	33
AcyI	GRCGYC	1 cut(s)	30
AfiI	CCNNNNNNNGG	1 cut(s)	257
AgsI	TTSAA	2 cut(s)	106, 221
AjiI	CACGTC	1 cut(s)	169
AluBI	AGCT	5 cut(s)	6, 69, 95, 206, 257
AluI	AGCT	5 cut(s)	6, 69, 95, 206, 257
Alw21I	GWGCWC	1 cut(s)	8
Alw26I	GTCTC	2 cut(s)	21, 159
BanII	GRGCYC	1 cut(s)	8
Bbv12I	GWGCWC	1 cut(s)	8
BccI	CCATC	1 cut(s)	235
BcoDI	GTCTC	2 cut(s)	21, 159
BfaI	CTAG	2 cut(s)	24, 265
BmgBI	CACGTC	1 cut(s)	169
BsaHI	GRCGYC	1 cut(s)	30
Bsc4I	CCNNNNNNNGG	1 cut(s)	257
Bse3DI	GCAATG	1 cut(s)	35
BseGI	GGATG	1 cut(s)	227
BseLI	CCNNNNNNNGG	1 cut(s)	257
BseMI	GCAATG	1 cut(s)	35
BsiHKAI	GWGCWC	1 cut(s)	8
BslI	CCNNNNNNNGG	1 cut(s)	257
BsmAI	GTCTC	2 cut(s)	21, 159
BsmBI	CGTCTC	2 cut(s)	21, 159
Bsp1286I	GDGCHC	1 cut(s)	8
BsrDI	GCAATG	1 cut(s)	35
BssNI	GRCGYC	1 cut(s)	30
Bst4CI	ACNGT	1 cut(s)	124
BstACI	GRCGYC	1 cut(s)	30
BstF5I	GGATG	1 cut(s)	227
BstMAI	GTCTC	2 cut(s)	21, 159
BstMWI	GCNNNNNNNGC	1 cut(s)	203
BtrI	CACGTC	1 cut(s)	169
BtsCI	GGATG	1 cut(s)	227
CviAII	CATG	1 cut(s)	198
CviJI	RGCY	7 cut(s)	6, 69, 95, 176, 189, 206, 257
CviKI_1	RGCY	7 cut(s)	6, 69, 95, 176, 189, 206, 257
Ecl136II	GAGCTC	1 cut(s)	6
Eco24I	GRGCYC	1 cut(s)	8
Eco53kI	GAGCTC	1 cut(s)	6
EcoICRI	GAGCTC	1 cut(s)	6
EcoT38I	GRGCYC	1 cut(s)	8
Esp3I	CGTCTC	2 cut(s)	21, 159
FaeI	CATG	1 cut(s)	201
FaiI	YATR	3 cut(s)	87, 92, 199
FatI	CATG	1 cut(s)	197
FokI	GGATG	1 cut(s)	214
FriOI	GRGCYC	1 cut(s)	8
FspBI	CTAG	2 cut(s)	24, 265
Hin1I	GRCGYC	1 cut(s)	30
Hin1II	CATG	1 cut(s)	201
HindIII	AAGCTT	1 cut(s)	204
Hpy188I	TCNGA	1 cut(s)	164
Hpy99I	CGWCG	1 cut(s)	35
HpyCH4III	ACNGT	1 cut(s)	124
HpyCH4IV	ACGT	2 cut(s)	30, 168
HpyF10VI	GCNNNNNNNGC	1 cut(s)	203
HpySE526I	ACGT	2 cut(s)	30, 168
Hsp92I	GRCGYC	1 cut(s)	30
Hsp92II	CATG	1 cut(s)	201
LpnPI	CCDG	4 cut(s)	30, 79, 113, 243
MaeI	CTAG	2 cut(s)	24, 265
MaeII	ACGT	2 cut(s)	30, 168
MaeIII	GTNAC	2 cut(s)	47, 260
MhlI	GDGCHC	1 cut(s)	8
MluCI	AATT	1 cut(s)	158
MnlI	CCTC	2 cut(s)	158, 166
MwoI	GCNNNNNNNGC	1 cut(s)	203
NlaIII	CATG	1 cut(s)	201
NmuCI	GTSAC	1 cut(s)	260
Psp124BI	GAGCTC	1 cut(s)	8
SacI	GAGCTC	1 cut(s)	8
SduI	GDGCHC	1 cut(s)	8
Sse9I	AATT	1 cut(s)	158
SspMI	CTAG	2 cut(s)	24, 265
SstI	GAGCTC	1 cut(s)	8
TaaI	ACNGT	1 cut(s)	124
TaiI	ACGT	2 cut(s)	33, 171
TaqI	TCGA	1 cut(s)	132
TasI	AATT	1 cut(s)	158
TseFI	GTSAC	1 cut(s)	260
Tsp45I	GTSAC	1 cut(s)	260
XspI	CTAG	2 cut(s)	24, 265
ZraI	GACGTC	1 cut(s)	31

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.