Rh4AG210400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0003271
Physical Location & Seq
Reverse (-)
50349944 .. 50350150
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG210400.1

Sequence Viewer

Length: 207 bp
ATGAATCGCTGTGGCGGAGGAGGACTTGGGAGTGGAACCGCTGTCATCGTTGGAGGAGAAGTCGTCGACTTCGAATTCGGCGCTGTGATCTGCGAAGAAGTGGTGGCTGGAGGAGGCGAAGGAGCCTGGTCAACATCCCCAATCTCCGATTCACTTCCTTCAGGTTCAGCATTCTTCCGATCTGGATTAGGACCAGCCAGTCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

6.58

Weight (kDa)

4.25

Isoelectric Point (pI)

40.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 198
AccI GTMKAC 1 cut(s) 66
AciI CCGC 2 cut(s) 15, 39
AcsI RAATTY 1 cut(s) 74
AcuI CTGAAG 1 cut(s) 144
AjnI CCWGG 1 cut(s) 125
AjuI GAANNNNNNNTTGG 2 cut(s) 133, 165
ApoI RAATTY 1 cut(s) 74
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspLEI GCGC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 191
AsuII TTCGAA 1 cut(s) 72
AvaII GGWCC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 127
BfoI RGCGCY 1 cut(s) 84
Bme1390I CCNGG 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 2 cut(s) 37, 124
BmrFI CCNGG 1 cut(s) 127
BpmI CTGGAG 1 cut(s) 129
Bpu14I TTCGAA 1 cut(s) 72
BsaXI ACNNNNNCTCC 4 cut(s) 45, 48, 75, 78
Bse1I ACTGG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 127
BseGI GGATG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 198
BseRI GAGGAG 3 cut(s) 33, 69, 126
BsmI GAATGC 1 cut(s) 170
Bsp119I TTCGAA 1 cut(s) 72
Bsp143I GATC 2 cut(s) 87, 179
BspACI CCGC 2 cut(s) 15, 39
BspLI GGNNCC 2 cut(s) 37, 124
BspT104I TTCGAA 1 cut(s) 72
BsrI ACTGG 1 cut(s) 198
BssMI GATC 2 cut(s) 87, 179
Bst2UI CCWGG 1 cut(s) 127
BstBI TTCGAA 1 cut(s) 72
BstF5I GGATG 1 cut(s) 134
BstH2I RGCGCY 1 cut(s) 84
BstHHI GCGC 1 cut(s) 83
BstKTI GATC 2 cut(s) 90, 182
BstMBI GATC 2 cut(s) 87, 179
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BtsCI GGATG 1 cut(s) 134
CfoI GCGC 1 cut(s) 83
Cfr13I GGNCC 1 cut(s) 191
CviJI RGCY 3 cut(s) 107, 125, 197
CviKI_1 RGCY 3 cut(s) 107, 125, 197
DpnI GATC 2 cut(s) 89, 181
DpnII GATC 2 cut(s) 87, 179
DrdI GACNNNNNNGTC 1 cut(s) 198
DseDI GACNNNNNNGTC 1 cut(s) 198
EciI GGCGGA 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 191
Eco57I CTGAAG 1 cut(s) 144
EcoRI GAATTC 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 125
FblI GTMKAC 1 cut(s) 66
FokI GGATG 1 cut(s) 121
GlaI GCGC 1 cut(s) 82
GsuI CTGGAG 1 cut(s) 129
HaeII RGCGCY 1 cut(s) 84
HhaI GCGC 1 cut(s) 83
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HincII GTYRAC 2 cut(s) 67, 132
HindII GTYRAC 2 cut(s) 67, 132
HinfI GANTC 2 cut(s) 4, 149
Hpy166II GTNNAC 2 cut(s) 67, 132
Hpy188I TCNGA 2 cut(s) 148, 179
Hpy188III TCNNGA 1 cut(s) 183
Hpy8I GTNNAC 2 cut(s) 67, 132
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 2 cut(s) 113, 168
HspAI GCGC 1 cut(s) 81
Kzo9I GATC 2 cut(s) 87, 179
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 5 cut(s) 93, 112, 139, 147, 168
MalI GATC 2 cut(s) 89, 181
MboI GATC 2 cut(s) 87, 179
MboII GAAGA 2 cut(s) 107, 166
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 5 cut(s) 11, 14, 47, 104, 107
MspA1I CMGCKG 1 cut(s) 41
MspR9I CCNGG 1 cut(s) 127
Mva1269I GAATGC 1 cut(s) 170
MvaI CCWGG 1 cut(s) 127
NdeII GATC 2 cut(s) 87, 179
NlaIV GGNNCC 2 cut(s) 37, 124
NspV TTCGAA 1 cut(s) 72
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PctI GAATGC 1 cut(s) 170
PfeI GAWTC 2 cut(s) 4, 149
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 2 cut(s) 37, 124
PspPI GGNCC 1 cut(s) 191
SalI GTCGAC 1 cut(s) 65
Sau3AI GATC 2 cut(s) 87, 179
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 127
SetI ASST 1 cut(s) 166
SfuI TTCGAA 1 cut(s) 72
SgeI CNNG 6 cut(s) 38, 120, 138, 139, 174, 195
SinI GGWCC 1 cut(s) 191
Sse9I AATT 1 cut(s) 74
SsiI CCGC 2 cut(s) 15, 39
StyD4I CCNGG 1 cut(s) 125
TaqI TCGA 2 cut(s) 66, 72
TasI AATT 1 cut(s) 74
TfiI GAWTC 2 cut(s) 4, 149
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.