Rh4CG014000

ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
2286717 .. 2287651
935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG014000.1

Sequence Viewer

Length: 330 bp
ATGGAGTTGTGTATAGTAAATTTTGCACAGCCTTTGGACTTGAGCTCTGGAGGAGCTGAATCAGCTGATAGCAACACAACCATCTTGCCAGATAAGAGAAGGAATAAAAGGAAGGGTGCCAATGAGGAGGAGAAGGAAAACACACTTCTGCTATCAAAAAGCACCGTGGCTTTAGTGAAATATACGATTCCAGAAGGTGCATATGCTATTCTGCAGTCATCACAAAATATTGGCCAGGTCGAATCAAGAAAGAGAAAACGAAGCAGAGCCCTAGCATTCTCCAAAGCTGGAATTGAAGTTTCCCATGCTGACCAACCATTAAGAAGATAG

Protein Analysis

109

Amino Acids

12.0

Weight (kDa)

9.61

Isoelectric Point (pI)

77.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 116
AcoI YGGCCR 1 cut(s) 232
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 1 cut(s) 296
AjnI CCWGG 1 cut(s) 234
AluBI AGCT 4 cut(s) 45, 56, 65, 287
AluI AGCT 4 cut(s) 45, 56, 65, 287
Alw21I GWGCWC 1 cut(s) 47
AoxI GGCC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 19
BalI TGGCCA 1 cut(s) 234
BanI GGYRCC 1 cut(s) 116
BanII GRGCYC 2 cut(s) 47, 271
Bbv12I GWGCWC 1 cut(s) 47
BccI CCATC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 236
BfaI CTAG 1 cut(s) 272
BfmI CTRYAG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 236
BmiI GGNNCC 1 cut(s) 118
BmrFI CCNGG 1 cut(s) 236
BpmI CTGGAG 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 165
BseBI CCWGG 1 cut(s) 236
BseDI CCNNGG 1 cut(s) 165
BseRI GAGGAG 3 cut(s) 66, 140, 143
BshFI GGCC 1 cut(s) 234
BshNI GGYRCC 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 47
BsmI GAATGC 1 cut(s) 275
BsnI GGCC 1 cut(s) 234
Bsp1286I GDGCHC 2 cut(s) 47, 271
BspANI GGCC 1 cut(s) 234
BspLI GGNNCC 1 cut(s) 118
BspMAI CTGCAG 1 cut(s) 216
BspT107I GGYRCC 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 165
Bst2UI CCWGG 1 cut(s) 236
Bst4CI ACNGT 1 cut(s) 166
BstDSI CCRYGG 1 cut(s) 165
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 234
BstSFI CTRYAG 1 cut(s) 212
BsuRI GGCC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 165
CviAII CATG 1 cut(s) 305
CviJI RGCY 8 cut(s) 31, 45, 56, 65, 170, 234, 269, 287
CviKI_1 RGCY 8 cut(s) 31, 45, 56, 65, 170, 234, 269, 287
EaeI YGGCCR 1 cut(s) 232
Ecl136II GAGCTC 1 cut(s) 45
Eco24I GRGCYC 2 cut(s) 47, 271
Eco53kI GAGCTC 1 cut(s) 45
EcoICRI GAGCTC 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 234
EcoT38I GRGCYC 2 cut(s) 47, 271
FaeI CATG 1 cut(s) 308
FaiI YATR 5 cut(s) 14, 183, 202, 204, 306
FatI CATG 1 cut(s) 304
FauNDI CATATG 1 cut(s) 202
FriOI GRGCYC 2 cut(s) 47, 271
FspBI CTAG 1 cut(s) 272
GsuI CTGGAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 1 cut(s) 308
HinfI GANTC 3 cut(s) 59, 187, 242
Hpy188III TCNNGA 3 cut(s) 48, 191, 246
HpyAV CCTTC 4 cut(s) 93, 106, 127, 188
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4V TGCA 3 cut(s) 26, 200, 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
Hsp92II CATG 1 cut(s) 308
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 6 cut(s) 33, 102, 204, 221, 248, 273
MaeI CTAG 1 cut(s) 272
MhlI GDGCHC 2 cut(s) 47, 271
MlsI TGGCCA 1 cut(s) 234
MluCI AATT 2 cut(s) 19, 291
MluNI TGGCCA 1 cut(s) 234
MnlI CCTC 3 cut(s) 44, 118, 121
Mox20I TGGCCA 1 cut(s) 234
MscI TGGCCA 1 cut(s) 234
MseI TTAA 1 cut(s) 320
Msp20I TGGCCA 1 cut(s) 234
MspA1I CMGCKG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 236
Mva1269I GAATGC 1 cut(s) 275
MvaI CCWGG 1 cut(s) 236
MwoI GCNNNNNNNGC 1 cut(s) 62
NdeI CATATG 1 cut(s) 202
NlaIII CATG 1 cut(s) 308
NlaIV GGNNCC 1 cut(s) 118
PctI GAATGC 1 cut(s) 275
PfeI GAWTC 3 cut(s) 59, 187, 242
Psp124BI GAGCTC 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 234
PspGI CCWGG 1 cut(s) 234
PspN4I GGNNCC 1 cut(s) 118
PstI CTGCAG 1 cut(s) 216
PvuII CAGCTG 1 cut(s) 65
SacI GAGCTC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 320
ScrFI CCNGG 1 cut(s) 236
SduI GDGCHC 2 cut(s) 47, 271
SetI ASST 6 cut(s) 47, 58, 67, 199, 240, 289
SfcI CTRYAG 1 cut(s) 212
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
Sse9I AATT 2 cut(s) 19, 291
SspI AATATT 1 cut(s) 229
SspMI CTAG 1 cut(s) 272
SstI GAGCTC 1 cut(s) 47
StyD4I CCNGG 1 cut(s) 234
TaaI ACNGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 240
TasI AATT 2 cut(s) 19, 291
TfiI GAWTC 3 cut(s) 59, 187, 242
Tru1I TTAA 1 cut(s) 320
Tru9I TTAA 1 cut(s) 320
XapI RAATTY 1 cut(s) 19
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.