Rh5AG363800

Belongs to the adenylate kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
61492478 .. 61493515
1038 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG363800.1

Sequence Viewer

Length: 210 bp
ATGAAAGTGGATGAGAAGATCAATAAGCTTGATGTTGAACTTAATAGATACAAAGAGCAGATCAAGAAGACAAGGCATGGCCTCAAACCCATGAATCTTCTGCCCTCTCTAAGGGGTTTATTTGTACGGAAAATGTTGGCGTTTGATTTGCCTGGAGGGATTCCAGAGTCTTGGCCAACGTTGTTTGAAGTTATTGATCTTGATGACTAG

Protein Analysis

69

Amino Acids

8.05

Weight (kDa)

8.03

Isoelectric Point (pI)

27.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 179
AcoI YGGCCR 1 cut(s) 173
AfaI GTAC 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 2 cut(s) 38, 188
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AoxI GGCC 2 cut(s) 79, 173
BalI TGGCCA 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 153
BfaI CTAG 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 153
BseGI GGATG 1 cut(s) 16
BseLI CCNNNNNNNGG 1 cut(s) 111
BshFI GGCC 2 cut(s) 81, 175
BslI CCNNNNNNNGG 1 cut(s) 111
BsnI GGCC 2 cut(s) 81, 175
Bsp143I GATC 3 cut(s) 18, 60, 196
BspANI GGCC 2 cut(s) 81, 175
BssMI GATC 3 cut(s) 18, 60, 196
Bst2UI CCWGG 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 110
BstENI CCTNNNNNAGG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 3 cut(s) 21, 63, 199
BstMBI GATC 3 cut(s) 18, 60, 196
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BstV2I GAAGAC 1 cut(s) 74
BstXI CCANNNNNNTGG 1 cut(s) 171
BsuRI GGCC 2 cut(s) 81, 175
BtsCI GGATG 1 cut(s) 16
Csp6I GTAC 1 cut(s) 125
CviAII CATG 2 cut(s) 77, 91
CviJI RGCY 3 cut(s) 28, 81, 175
CviKI_1 RGCY 3 cut(s) 28, 81, 175
CviQI GTAC 1 cut(s) 125
DdeI CTNAG 1 cut(s) 110
DpnI GATC 3 cut(s) 20, 62, 198
DpnII GATC 3 cut(s) 18, 60, 196
EaeI YGGCCR 1 cut(s) 173
EcoNI CCTNNNNNAGG 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 151
FaeI CATG 2 cut(s) 80, 94
FaiI YATR 2 cut(s) 78, 92
FatI CATG 2 cut(s) 76, 90
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 208
GsuI CTGGAG 1 cut(s) 174
HaeIII GGCC 2 cut(s) 81, 175
Hin1II CATG 2 cut(s) 80, 94
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 3 cut(s) 94, 160, 167
Hpy188III TCNNGA 3 cut(s) 64, 164, 200
HpyCH4IV ACGT 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 110
HpySE526I ACGT 1 cut(s) 179
Hsp92II CATG 2 cut(s) 80, 94
Kzo9I GATC 3 cut(s) 18, 60, 196
LpnPI CCDG 3 cut(s) 138, 165, 177
MaeI CTAG 1 cut(s) 208
MaeII ACGT 1 cut(s) 179
MalI GATC 3 cut(s) 20, 62, 198
MboI GATC 3 cut(s) 18, 60, 196
MboII GAAGA 3 cut(s) 28, 79, 89
MlsI TGGCCA 1 cut(s) 175
MluNI TGGCCA 1 cut(s) 175
MlyI GAGTC 1 cut(s) 176
MnlI CCTC 3 cut(s) 92, 115, 149
Mox20I TGGCCA 1 cut(s) 175
MscI TGGCCA 1 cut(s) 175
MseI TTAA 1 cut(s) 42
Msp20I TGGCCA 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
NdeII GATC 3 cut(s) 18, 60, 196
NlaIII CATG 2 cut(s) 80, 94
PfeI GAWTC 2 cut(s) 94, 160
PleI GAGTC 1 cut(s) 175
PpsI GAGTC 1 cut(s) 175
Psp1406I AACGTT 1 cut(s) 179
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SaqAI TTAA 1 cut(s) 42
Sau3AI GATC 3 cut(s) 18, 60, 196
SchI GAGTC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 153
SetI ASST 2 cut(s) 30, 182
SgeI CNNG 9 cut(s) 41, 76, 84, 89, 103, 164, 165, 176, 183
SspMI CTAG 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 151
TaiI ACGT 1 cut(s) 182
TfiI GAWTC 2 cut(s) 94, 160
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TspDTI ATGAA 2 cut(s) 17, 107
TspGWI ACGGA 1 cut(s) 142
XagI CCTNNNNNAGG 1 cut(s) 109
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.