Rh5BG354200

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
54838089 .. 54838574
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG354200.1

Sequence Viewer

Length: 486 bp
ATGATTAGGCTGCACATTCCGACAGAGGCTGGTCATTACGGTATCCTTATTGAGAACTTCTGCAAGGCTGGGGTGTATGATCGAGCAGTTCACTTGCTTGATAAGCTCATTGAGAAAGAAATTATTATGAGGCCCCAGAGTTCTATGGAATTGGAGGCTAGTGCTTACAACCCAATGATTGAGTATCCATGCAACCATGGGCAGACAGGTAAAGCTGAAGTCCTTTTCAGGCAGTTGATGAAAAAGGGAGTTCAGGATTCAGTTGCTTTCAATAATTTGATCCGTGGGCATGCTAAGGAAGGAAATTCTGATTCTGCTTTTGAGATTTTAAAGATTATGGGTAGAAGAGGGGTTCCTAGAGAAGCAGATTCCTACAAGCTGCTCATTAAGAGCTACATAAGTAAAGGTGAACCAGCTGATGCTAAAACAGCTTTGGACAGTATGATTGAAAATGGGCATGTTCCAGAATCATCACTATTCAGGTGA

Protein Analysis

161

Amino Acids

18.05

Weight (kDa)

7.02

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 86 - 131 1.7e-08 PPR repeat family
PPR PF01535 88 - 118 4.4e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 274
AcsI RAATTY 1 cut(s) 304
AcuI CTGAAG 1 cut(s) 237
AgsI TTSAA 2 cut(s) 271, 449
AluBI AGCT 6 cut(s) 106, 215, 379, 393, 416, 431
AluI AGCT 6 cut(s) 106, 215, 379, 393, 416, 431
AlwI GGATC 1 cut(s) 274
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 1 cut(s) 131
ApeKI GCWGC 2 cut(s) 10, 379
ApoI RAATTY 1 cut(s) 304
AspS9I GGNCC 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 419
BbvI GCAGC 1 cut(s) 366
BciVI GTATCC 2 cut(s) 53, 195
BfaI CTAG 2 cut(s) 159, 357
BfuI GTATCC 2 cut(s) 53, 195
BisI GCNGC 2 cut(s) 11, 380
BlsI GCNGC 2 cut(s) 12, 381
BmgT120I GGNCC 1 cut(s) 132
BmiI GGNNCC 2 cut(s) 134, 354
BmsI GCATC 1 cut(s) 409
Bpu10I CCTNAGC 1 cut(s) 294
BsaJI CCNNGG 2 cut(s) 196, 283
BseDI CCNNGG 2 cut(s) 196, 283
BseXI GCAGC 1 cut(s) 366
BseYI CCCAGC 1 cut(s) 68
BshFI GGCC 1 cut(s) 133
BsnI GGCC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 79, 279
Bsp19I CCATGG 1 cut(s) 196
BspANI GGCC 1 cut(s) 133
BspLI GGNNCC 2 cut(s) 134, 354
BspPI GGATC 1 cut(s) 274
BssECI CCNNGG 2 cut(s) 196, 283
BssMI GATC 2 cut(s) 79, 279
BssT1I CCWWGG 1 cut(s) 196
Bst4CI ACNGT 2 cut(s) 41, 440
Bst6I CTCTTC 1 cut(s) 340
BstC8I GCNNGC 1 cut(s) 291
BstDEI CTNAG 1 cut(s) 294
BstDSI CCRYGG 2 cut(s) 196, 283
BstKTI GATC 2 cut(s) 82, 282
BstMBI GATC 2 cut(s) 79, 279
BstMWI GCNNNNNNNGC 2 cut(s) 103, 428
BstNSI RCATGY 2 cut(s) 293, 461
BstV1I GCAGC 1 cut(s) 366
BsuI GTATCC 2 cut(s) 53, 195
BsuRI GGCC 1 cut(s) 133
BtgI CCRYGG 2 cut(s) 196, 283
Cac8I GCNNGC 1 cut(s) 291
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 132
CviAII CATG 4 cut(s) 189, 197, 290, 458
DdeI CTNAG 1 cut(s) 294
DpnI GATC 2 cut(s) 81, 281
DpnII GATC 2 cut(s) 79, 279
DraI TTTAAA 1 cut(s) 330
Eam1104I CTCTTC 1 cut(s) 340
EarI CTCTTC 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 196
Eco57I CTGAAG 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 4 cut(s) 192, 200, 293, 461
FatI CATG 4 cut(s) 188, 196, 289, 457
Fnu4HI GCNGC 2 cut(s) 11, 380
Fsp4HI GCNGC 2 cut(s) 11, 380
FspBI CTAG 2 cut(s) 159, 357
GluI GCNGC 2 cut(s) 11, 380
GsaI CCCAGC 1 cut(s) 72
HaeIII GGCC 1 cut(s) 133
Hin1II CATG 4 cut(s) 192, 200, 293, 461
HinfI GANTC 4 cut(s) 257, 311, 368, 467
HphI GGTGA 1 cut(s) 419
Hpy166II GTNNAC 2 cut(s) 91, 410
Hpy188I TCNGA 2 cut(s) 21, 310
Hpy188III TCNNGA 2 cut(s) 254, 464
Hpy8I GTNNAC 2 cut(s) 91, 410
HpyAV CCTTC 1 cut(s) 293
HpyCH4III ACNGT 2 cut(s) 41, 440
HpyCH4V TGCA 3 cut(s) 13, 63, 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 103, 428
HpyF3I CTNAG 1 cut(s) 294
Hsp92II CATG 4 cut(s) 192, 200, 293, 461
Kzo9I GATC 2 cut(s) 79, 279
LpnPI CCDG 9 cut(s) 15, 54, 149, 192, 214, 239, 426, 466, 477
Lsp1109I GCAGC 1 cut(s) 366
LweI GCATC 1 cut(s) 409
MaeI CTAG 2 cut(s) 159, 357
MalI GATC 2 cut(s) 81, 281
MboI GATC 2 cut(s) 79, 279
MboII GAAGA 1 cut(s) 357
MluCI AATT 4 cut(s) 120, 149, 274, 304
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 4 cut(s) 19, 123, 148, 341
MseI TTAA 2 cut(s) 329, 387
MspA1I CMGCKG 1 cut(s) 416
MwoI GCNNNNNNNGC 2 cut(s) 103, 428
NcoI CCATGG 1 cut(s) 196
NdeII GATC 2 cut(s) 79, 279
NlaIII CATG 4 cut(s) 192, 200, 293, 461
NlaIV GGNNCC 2 cut(s) 134, 354
NspI RCATGY 2 cut(s) 293, 461
PaeI GCATGC 1 cut(s) 293
PfeI GAWTC 4 cut(s) 257, 311, 368, 467
PkrI GCNGC 2 cut(s) 12, 381
PspFI CCCAGC 1 cut(s) 68
PspN4I GGNNCC 2 cut(s) 134, 354
PspPI GGNCC 1 cut(s) 132
PstNI CAGNNNCTG 1 cut(s) 29
PvuII CAGCTG 1 cut(s) 416
SaqAI TTAA 2 cut(s) 329, 387
SatI GCNGC 2 cut(s) 11, 380
Sau3AI GATC 2 cut(s) 79, 279
Sau96I GGNCC 1 cut(s) 132
SetI ASST 9 cut(s) 108, 211, 217, 381, 395, 409, 418, 433, 485
SfaNI GCATC 1 cut(s) 409
SphI GCATGC 1 cut(s) 293
Sse9I AATT 4 cut(s) 120, 149, 274, 304
SspMI CTAG 2 cut(s) 159, 357
StyI CCWWGG 1 cut(s) 196
TaaI ACNGT 2 cut(s) 41, 440
TaqI TCGA 1 cut(s) 82
TasI AATT 4 cut(s) 120, 149, 274, 304
TfiI GAWTC 4 cut(s) 257, 311, 368, 467
Tru1I TTAA 2 cut(s) 329, 387
Tru9I TTAA 2 cut(s) 329, 387
TseI GCWGC 2 cut(s) 10, 379
TspDTI ATGAA 1 cut(s) 254
TspGWI ACGGA 1 cut(s) 272
XapI RAATTY 1 cut(s) 304
XceI RCATGY 2 cut(s) 293, 461
XspI CTAG 2 cut(s) 159, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.