Rh5DG347000

Serine threonine-protein phosphatase 6 regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
47416013 .. 47419357
3345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG347000.1

Sequence Viewer

Length: 792 bp
ATGGAGGACTCTCAACGAAAATCTGTTCTCACTAGCTCATTATCAGTTTGCATCTCTTTGTTAGACCGTGAGAGGGAAGCTTTGAGAACAAATGCATGTACTGGTGAACACCAGCCTGCTCATGGATCTACAATTACTGTTAATAACGAGATTGTTGTGGCCATGCTCAACAGCCTAGGTGATTTGCTGAAACTTTTAGATGTTTCATCGGCGGACAATATGTTGTTAACTACATATGGCAAGTTACAGCCACCGCTTGGAAAACATCGTTTGAAGATTGTAGAGTTCATTTCAGTATTACTGTCAGTTCGTAGTCAAGCTGCTGAGAAGGAATTGATTCGTTTTGCAGCAATACAAAAAGTCTTAGACTTATTTTTTAAGTACCCATATAACAATTTTTTGCATCACCACATAGAGAACATAATCATATCATGTTTGGAAAGCAAAAATGGGCCTCTTGTACAACATATTCTTCGTGAATGTGATCTTGTTGGAAAAATACTTGAAGCAGAAAAGAATTTCACACTGGCCGCTGATTCATTTATGCCAACAATTCCTGCTAAGGGTCGATCCCCACCCAGGAACGGCAATATTGGACATTTGACATGTATATCCAACAAAATCATTCAACTGGGAAACAACAATAGGGAGATTCAGGCATATCTGCAGGAAAACAGTGTCTGGACTGAATGGCATACAGAAGTCCTATTAAAGCGTAATGCAGTGGAGAATGTCTCCCAGTGGGCGTGCGGGCGGCCTATATCATCTCTGGATCGTGGACGCTCAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

263

Amino Acids

29.43

Weight (kDa)

8.21

Isoelectric Point (pI)

47.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SAPS PF04499 5 - 111 4.8e-16 SIT4 phosphatase-associated protein
SAPS PF04499 112 - 245 1.7e-27 SIT4 phosphatase-associated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 257
AciI CCGC 5 cut(s) 212, 254, 531, 750, 754
AclWI GGATC 3 cut(s) 133, 564, 780
AcoI YGGCCR 2 cut(s) 159, 528
AcsI RAATTY 1 cut(s) 517
AfaI GTAC 3 cut(s) 100, 383, 462
AfiI CCNNNNNNNGG 6 cut(s) 73, 122, 257, 563, 579, 584
AflIII ACRYGT 1 cut(s) 605
AgsI TTSAA 3 cut(s) 274, 506, 629
AjnI CCWGG 1 cut(s) 578
AluBI AGCT 4 cut(s) 36, 80, 320, 789
AluI AGCT 4 cut(s) 36, 80, 320, 789
Alw26I GTCTC 1 cut(s) 739
AlwI GGATC 3 cut(s) 133, 564, 780
AlwNI CAGNNNCTG 1 cut(s) 681
AoxI GGCC 4 cut(s) 159, 452, 528, 755
ApeKI GCWGC 2 cut(s) 320, 347
ApoI RAATTY 1 cut(s) 517
Asp700I GAANNNNTTC 1 cut(s) 336
AspA2I CCTAGG 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 452
AsuHPI GGTGA 3 cut(s) 116, 191, 398
AvrII CCTAGG 1 cut(s) 175
BalI TGGCCA 1 cut(s) 161
BbvI GCAGC 2 cut(s) 307, 359
BceAI ACGGC 1 cut(s) 601
BciT130I CCWGG 1 cut(s) 580
BcoDI GTCTC 1 cut(s) 739
BfaI CTAG 3 cut(s) 33, 176, 790
BfmI CTRYAG 1 cut(s) 665
BisI GCNGC 4 cut(s) 321, 348, 531, 755
BlnI CCTAGG 1 cut(s) 175
BlsI GCNGC 4 cut(s) 322, 349, 532, 756
Bme1390I CCNGG 1 cut(s) 580
BmgT120I GGNCC 1 cut(s) 452
BmrFI CCNGG 1 cut(s) 580
BmrI ACTGGG 2 cut(s) 641, 733
BmsI GCATC 2 cut(s) 60, 412
BmuI ACTGGG 2 cut(s) 641, 733
BplI GAGNNNNNCTC 2 cut(s) 719, 751
Bpu10I CCTNAGC 1 cut(s) 561
BpuEI CTTGAG 1 cut(s) 769
BsaJI CCNNGG 2 cut(s) 175, 578
Bsc4I CCNNNNNNNGG 6 cut(s) 73, 122, 257, 563, 579, 584
Bse1I ACTGG 4 cut(s) 106, 531, 636, 739
BseBI CCWGG 1 cut(s) 580
BseDI CCNNGG 2 cut(s) 175, 578
BseLI CCNNNNNNNGG 6 cut(s) 73, 122, 257, 563, 579, 584
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 4 cut(s) 106, 531, 636, 739
BseXI GCAGC 2 cut(s) 307, 359
BshFI GGCC 4 cut(s) 161, 454, 530, 757
BslI CCNNNNNNNGG 6 cut(s) 73, 122, 257, 563, 579, 584
BsmAI GTCTC 1 cut(s) 739
BsnI GGCC 4 cut(s) 161, 454, 530, 757
Bsp1407I TGTACA 1 cut(s) 460
Bsp143I GATC 4 cut(s) 125, 484, 569, 772
BspACI CCGC 5 cut(s) 212, 254, 531, 750, 754
BspANI GGCC 4 cut(s) 161, 454, 530, 757
BspCNI CTCAG 1 cut(s) 316
BspMAI CTGCAG 1 cut(s) 669
BspPI GGATC 3 cut(s) 133, 564, 780
BsrGI TGTACA 1 cut(s) 460
BsrI ACTGG 4 cut(s) 106, 531, 636, 739
BssECI CCNNGG 2 cut(s) 175, 578
BssMI GATC 4 cut(s) 125, 484, 569, 772
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 580
Bst4CI ACNGT 4 cut(s) 68, 139, 303, 677
BstAUI TGTACA 1 cut(s) 460
BstC8I GCNNGC 3 cut(s) 117, 748, 752
BstDEI CTNAG 3 cut(s) 324, 364, 561
BstKTI GATC 4 cut(s) 128, 487, 572, 775
BstMAI GTCTC 1 cut(s) 739
BstMBI GATC 4 cut(s) 125, 484, 569, 772
BstNI CCWGG 1 cut(s) 580
BstNSI RCATGY 2 cut(s) 99, 609
BstSCI CCNGG 1 cut(s) 578
BstSFI CTRYAG 1 cut(s) 665
BstV1I GCAGC 2 cut(s) 307, 359
BstX2I RGATCY 1 cut(s) 125
BstYI RGATCY 1 cut(s) 125
BsuRI GGCC 4 cut(s) 161, 454, 530, 757
BtsI GCAGTG 1 cut(s) 729
BtsIMutI CAGTG 4 cut(s) 524, 682, 729, 746
Cac8I GCNNGC 3 cut(s) 117, 748, 752
CaiI CAGNNNCTG 1 cut(s) 681
Cfr13I GGNCC 1 cut(s) 452
Csp6I GTAC 3 cut(s) 99, 382, 461
CviAII CATG 5 cut(s) 96, 122, 163, 432, 606
CviQI GTAC 3 cut(s) 99, 382, 461
DdeI CTNAG 3 cut(s) 324, 364, 561
DpnI GATC 4 cut(s) 127, 486, 571, 774
DpnII GATC 4 cut(s) 125, 484, 569, 772
EaeI YGGCCR 2 cut(s) 159, 528
EciI GGCGGA 1 cut(s) 227
Eco130I CCWWGG 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 578
EcoT14I CCWWGG 1 cut(s) 175
EcoT22I ATGCAT 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 5 cut(s) 99, 125, 166, 435, 609
FatI CATG 5 cut(s) 95, 121, 162, 431, 605
FauI CCCGC 1 cut(s) 743
FauNDI CATATG 1 cut(s) 235
Fnu4HI GCNGC 4 cut(s) 321, 348, 531, 755
Fsp4HI GCNGC 4 cut(s) 321, 348, 531, 755
FspBI CTAG 3 cut(s) 33, 176, 790
GluI GCNGC 4 cut(s) 321, 348, 531, 755
HaeIII GGCC 4 cut(s) 161, 454, 530, 757
Hin1II CATG 5 cut(s) 99, 125, 166, 435, 609
HincII GTYRAC 1 cut(s) 228
HindII GTYRAC 1 cut(s) 228
HindIII AAGCTT 1 cut(s) 78
HinfI GANTC 4 cut(s) 8, 337, 536, 652
HpaI GTTAAC 1 cut(s) 228
HphI GGTGA 3 cut(s) 116, 191, 398
Hpy166II GTNNAC 3 cut(s) 107, 228, 779
Hpy188III TCNNGA 3 cut(s) 476, 682, 770
Hpy8I GTNNAC 3 cut(s) 107, 228, 779
HpyAV CCTTC 1 cut(s) 322
HpyCH4III ACNGT 4 cut(s) 68, 139, 303, 677
HpyCH4V TGCA 6 cut(s) 51, 95, 347, 403, 667, 722
HpyF3I CTNAG 3 cut(s) 324, 364, 561
Hsp92II CATG 5 cut(s) 99, 125, 166, 435, 609
KspAI GTTAAC 1 cut(s) 228
Kzo9I GATC 4 cut(s) 125, 484, 569, 772
Lsp1109I GCAGC 2 cut(s) 307, 359
LweI GCATC 2 cut(s) 60, 412
MaeI CTAG 3 cut(s) 33, 176, 790
MaeIII GTNAC 1 cut(s) 243
MalI GATC 4 cut(s) 127, 486, 571, 774
MboI GATC 4 cut(s) 125, 484, 569, 772
MboII GAAGA 2 cut(s) 286, 464
MflI RGATCY 1 cut(s) 125
MlsI TGGCCA 1 cut(s) 161
MluCI AATT 5 cut(s) 132, 332, 394, 517, 552
MluNI TGGCCA 1 cut(s) 161
MlyI GAGTC 1 cut(s) 2
MmeI TCCRAC 2 cut(s) 472, 639
MnlI CCTC 2 cut(s) 66, 465
Mox20I TGGCCA 1 cut(s) 161
Mph1103I ATGCAT 1 cut(s) 97
MroXI GAANNNNTTC 1 cut(s) 336
MscI TGGCCA 1 cut(s) 161
MseI TTAA 4 cut(s) 141, 227, 378, 710
Msp20I TGGCCA 1 cut(s) 161
MspA1I CMGCKG 1 cut(s) 533
MspR9I CCNGG 1 cut(s) 580
MvaI CCWGG 1 cut(s) 580
NdeI CATATG 1 cut(s) 235
NdeII GATC 4 cut(s) 125, 484, 569, 772
NlaIII CATG 5 cut(s) 99, 125, 166, 435, 609
NsiI ATGCAT 1 cut(s) 97
NspI RCATGY 2 cut(s) 99, 609
PciI ACATGT 1 cut(s) 605
PdmI GAANNNNTTC 1 cut(s) 336
PfeI GAWTC 3 cut(s) 337, 536, 652
PflMI CCANNNNNTGG 1 cut(s) 257
PkrI GCNGC 4 cut(s) 322, 349, 532, 756
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
PscI ACATGT 1 cut(s) 605
Psp6I CCWGG 1 cut(s) 578
PspGI CCWGG 1 cut(s) 578
PspPI GGNCC 1 cut(s) 452
PstI CTGCAG 1 cut(s) 669
PstNI CAGNNNCTG 1 cut(s) 681
PsuI RGATCY 1 cut(s) 125
RsaI GTAC 3 cut(s) 100, 383, 462
RsaNI GTAC 3 cut(s) 99, 382, 461
SaqAI TTAA 4 cut(s) 141, 227, 378, 710
SatI GCNGC 4 cut(s) 321, 348, 531, 755
Sau3AI GATC 4 cut(s) 125, 484, 569, 772
Sau96I GGNCC 1 cut(s) 452
SchI GAGTC 1 cut(s) 2
ScrFI CCNGG 1 cut(s) 580
SetI ASST 5 cut(s) 38, 82, 181, 322, 791
SfaNI GCATC 2 cut(s) 60, 412
SfcI CTRYAG 1 cut(s) 665
SmlI CTYRAG 1 cut(s) 784
SmoI CTYRAG 1 cut(s) 784
Sse9I AATT 5 cut(s) 132, 332, 394, 517, 552
SsiI CCGC 5 cut(s) 212, 254, 531, 750, 754
SspI AATATT 1 cut(s) 592
SspMI CTAG 3 cut(s) 33, 176, 790
StyD4I CCNGG 1 cut(s) 578
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 4 cut(s) 68, 139, 303, 677
TaqI TCGA 1 cut(s) 568
TasI AATT 5 cut(s) 132, 332, 394, 517, 552
TatI WGTACW 2 cut(s) 98, 460
TauI GCSGC 2 cut(s) 533, 757
TfiI GAWTC 3 cut(s) 337, 536, 652
Tru1I TTAA 4 cut(s) 141, 227, 378, 710
Tru9I TTAA 4 cut(s) 141, 227, 378, 710
TscAI CASTG 4 cut(s) 531, 682, 729, 746
TseI GCWGC 2 cut(s) 320, 347
TspDTI ATGAA 3 cut(s) 195, 277, 528
TspRI CASTG 4 cut(s) 531, 682, 729, 746
Van91I CCANNNNNTGG 1 cut(s) 257
XapI RAATTY 1 cut(s) 517
XceI RCATGY 2 cut(s) 99, 609
XcmI CCANNNNNNNNNTGG 1 cut(s) 119
XmaJI CCTAGG 1 cut(s) 175
XmnI GAANNNNTTC 1 cut(s) 336
XspI CTAG 3 cut(s) 33, 176, 790
Zsp2I ATGCAT 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.