Rh7CG151300

Exocyst subunit exo70 family protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
12409622 .. 12409828
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG151300.1

Sequence Viewer

Length: 207 bp
ATGGAGGTCTGCCGAGGATTGACGATTCAGATACTCAACTTCACCGACGCCGTCGCAATCAGAAGCCGATCGTCGGAGCGATTGTTCAAGGTGTTGGATGTGTTCGACTATGCGCTACTTGATGCCCGAATTCGATTCCTTGTTCTCGAATCAGTACTGCTTGTTTCTCAGGAACAAAGCAATTACGATCCAGAAAAGATTAGGTGA

Protein Analysis

68

Amino Acids

7.91

Weight (kDa)

5.24

Isoelectric Point (pI)

55.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 129
AcyI GRCGYC 1 cut(s) 48
AfaI GTAC 1 cut(s) 156
AfiI CCNNNNNNNGG 1 cut(s) 73
AgsI TTSAA 1 cut(s) 88
AloI GAACNNNNNNTCC 2 cut(s) 68, 100
AlwI GGATC 1 cut(s) 182
ApoI RAATTY 1 cut(s) 129
AspLEI GCGC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 34
BceAI ACGGC 1 cut(s) 35
BmcAI AGTACT 1 cut(s) 156
BmsI GCATC 1 cut(s) 112
BsaHI GRCGYC 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 13
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
Bsc4I CCNNNNNNNGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 13
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 182
Bsh1285I CGRYCG 1 cut(s) 71
BsiEI CGRYCG 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 73
Bsp143I GATC 2 cut(s) 68, 187
BspCNI CTCAG 1 cut(s) 181
BspPI GGATC 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 2 cut(s) 68, 187
BssNI GRCGYC 1 cut(s) 48
BstACI GRCGYC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 103
BstHHI GCGC 1 cut(s) 115
BstKTI GATC 2 cut(s) 71, 190
BstMBI GATC 2 cut(s) 68, 187
BstMCI CGRYCG 1 cut(s) 71
BtsCI GGATG 1 cut(s) 103
CfoI GCGC 1 cut(s) 115
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 155
CviJI RGCY 1 cut(s) 66
CviKI_1 RGCY 1 cut(s) 66
CviQI GTAC 1 cut(s) 155
DdeI CTNAG 1 cut(s) 168
DpnI GATC 2 cut(s) 70, 189
DpnII GATC 2 cut(s) 68, 187
EcoRI GAATTC 1 cut(s) 129
FaiI YATR 1 cut(s) 111
FokI GGATG 1 cut(s) 110
GlaI GCGC 1 cut(s) 114
HgaI GACGC 1 cut(s) 56
HhaI GCGC 1 cut(s) 115
Hin1I GRCGYC 1 cut(s) 48
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HinfI GANTC 3 cut(s) 25, 135, 149
HphI GGTGA 1 cut(s) 34
Hpy188I TCNGA 3 cut(s) 30, 62, 76
Hpy188III TCNNGA 3 cut(s) 146, 170, 191
Hpy99I CGWCG 3 cut(s) 50, 56, 76
HpyF3I CTNAG 1 cut(s) 168
Hsp92I GRCGYC 1 cut(s) 48
HspAI GCGC 1 cut(s) 113
Kzo9I GATC 2 cut(s) 68, 187
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 155
LweI GCATC 1 cut(s) 112
MalI GATC 2 cut(s) 70, 189
MboI GATC 2 cut(s) 68, 187
MluCI AATT 2 cut(s) 129, 181
MmeI TCCRAC 2 cut(s) 54, 75
MnlI CCTC 1 cut(s) 8
NdeII GATC 2 cut(s) 68, 187
NmeAIII GCCGAG 1 cut(s) 38
PfeI GAWTC 3 cut(s) 25, 135, 149
PflFI GACNNNGTC 1 cut(s) 50
Ple19I CGATCG 1 cut(s) 71
PsyI GACNNNGTC 1 cut(s) 50
PvuI CGATCG 1 cut(s) 71
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
Sau3AI GATC 2 cut(s) 68, 187
ScaI AGTACT 1 cut(s) 156
SetI ASST 3 cut(s) 9, 93, 206
SfaNI GCATC 1 cut(s) 112
SgeI CNNG 9 cut(s) 26, 100, 131, 138, 152, 158, 173, 182, 203
Sse9I AATT 2 cut(s) 129, 181
TaqI TCGA 3 cut(s) 105, 133, 147
TasI AATT 2 cut(s) 129, 181
TatI WGTACW 1 cut(s) 154
TfiI GAWTC 3 cut(s) 25, 135, 149
Tth111I GACNNNGTC 1 cut(s) 50
XapI RAATTY 1 cut(s) 129
ZrmI AGTACT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.