Rh7DG019900

S-adenosylmethionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0007511
Physical Location & Seq
Forward (+)
1608672 .. 1609114
443 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG019900.1

Sequence Viewer

Length: 354 bp
ATGGAGTCTAGTCTATCCGATATGGTTAATCAGGGTTTAATAAGTGGAGATAAACTTGACTCTTTCAACTTGCCTATCTACTCTCCATCCATGGAAGAGCTAAGGAAGATAATAGAAAACAGCGGGTGCTTCGATGTATTGAGGTTGGAGATCCAATTACCTGAGAGGCCAACCCCTTTGCGTAGTGAGAGTGCTAGATCAGGCTTTGAGAAAATTCTCACCAAACACTTTGGGACTGAAATTATAGAACCACTTTTCAATCGATACTCCAAGAAAGTACAAGGTCGTTCTCCTCTTACTTCTTGTGATGGTATGGCTGTTGGATTGCTCGTCCTTCTCAAGCGCAATCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

117

Amino Acids

13.13

Weight (kDa)

6.58

Isoelectric Point (pI)

70.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_7 PF03492 1 - 115 1.8e-23 SAM dependent carboxyl methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AclWI GGATC 1 cut(s) 145
AcsI RAATTY 1 cut(s) 213
AfaI GTAC 1 cut(s) 279
AgsI TTSAA 2 cut(s) 67, 259
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
AlwI GGATC 1 cut(s) 145
AoxI GGCC 1 cut(s) 167
ApoI RAATTY 1 cut(s) 213
AspLEI GCGC 1 cut(s) 345
AsuHPI GGTGA 1 cut(s) 211
BccI CCATC 2 cut(s) 94, 302
BfaI CTAG 2 cut(s) 9, 195
Bpu10I CCTNAGC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 323
Bsa29I ATCGAT 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 90
BseCI ATCGAT 1 cut(s) 262
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 153
BseRI GAGGAG 1 cut(s) 282
BshFI GGCC 1 cut(s) 169
BshVI ATCGAT 1 cut(s) 262
BslFI GGGAC 1 cut(s) 247
BsmFI GGGAC 1 cut(s) 247
BsnI GGCC 1 cut(s) 169
Bsp143I GATC 2 cut(s) 150, 197
Bsp19I CCATGG 1 cut(s) 90
BspACI CCGC 1 cut(s) 123
BspANI GGCC 1 cut(s) 169
BspCNI CTCAG 1 cut(s) 154
BspDI ATCGAT 1 cut(s) 262
BspPI GGATC 1 cut(s) 145
BspQI GCTCTTC 1 cut(s) 90
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 2 cut(s) 150, 197
BssT1I CCWWGG 1 cut(s) 90
Bst6I CTCTTC 1 cut(s) 90
BstDEI CTNAG 2 cut(s) 101, 162
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 86
BstHHI GCGC 1 cut(s) 345
BstKTI GATC 2 cut(s) 153, 200
BstMBI GATC 2 cut(s) 150, 197
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
Bsu15I ATCGAT 1 cut(s) 262
BsuRI GGCC 1 cut(s) 169
BsuTUI ATCGAT 1 cut(s) 262
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 86
CfoI GCGC 1 cut(s) 345
ClaI ATCGAT 1 cut(s) 262
Csp6I GTAC 1 cut(s) 278
CviAII CATG 1 cut(s) 91
CviJI RGCY 4 cut(s) 100, 169, 204, 317
CviKI_1 RGCY 4 cut(s) 100, 169, 204, 317
CviQI GTAC 1 cut(s) 278
DdeI CTNAG 2 cut(s) 101, 162
DpnI GATC 2 cut(s) 152, 199
DpnII GATC 2 cut(s) 150, 197
Eam1104I CTCTTC 1 cut(s) 90
EarI CTCTTC 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 1 cut(s) 94
FaiI YATR 4 cut(s) 23, 92, 245, 314
FaqI GGGAC 1 cut(s) 247
FatI CATG 1 cut(s) 90
FauI CCCGC 1 cut(s) 116
FokI GGATG 1 cut(s) 73
FspBI CTAG 2 cut(s) 9, 195
GlaI GCGC 1 cut(s) 344
HaeIII GGCC 1 cut(s) 169
HhaI GCGC 1 cut(s) 345
Hin1II CATG 1 cut(s) 94
Hin6I GCGC 1 cut(s) 343
HinP1I GCGC 1 cut(s) 343
HinfI GANTC 2 cut(s) 5, 59
HphI GGTGA 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 344
HpyF3I CTNAG 2 cut(s) 101, 162
Hsp92II CATG 1 cut(s) 94
HspAI GCGC 1 cut(s) 343
Kzo9I GATC 2 cut(s) 150, 197
LguI GCTCTTC 1 cut(s) 90
LpnPI CCDG 3 cut(s) 17, 174, 186
MaeI CTAG 2 cut(s) 9, 195
MalI GATC 2 cut(s) 152, 199
MboI GATC 2 cut(s) 150, 197
MboII GAAGA 2 cut(s) 107, 118
MflI RGATCY 1 cut(s) 150
MluCI AATT 3 cut(s) 155, 213, 240
MlyI GAGTC 2 cut(s) 14, 53
MmeI TCCRAC 2 cut(s) 126, 301
MnlI CCTC 3 cut(s) 135, 159, 303
MseI TTAA 3 cut(s) 27, 38, 352
MspA1I CMGCKG 1 cut(s) 123
NcoI CCATGG 1 cut(s) 90
NdeII GATC 2 cut(s) 150, 197
NlaIII CATG 1 cut(s) 94
PciSI GCTCTTC 1 cut(s) 90
PleI GAGTC 2 cut(s) 13, 53
PpsI GAGTC 2 cut(s) 13, 53
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 1 cut(s) 279
RsaNI GTAC 1 cut(s) 278
SapI GCTCTTC 1 cut(s) 90
SaqAI TTAA 3 cut(s) 27, 38, 352
Sau3AI GATC 2 cut(s) 150, 197
SchI GAGTC 2 cut(s) 14, 53
SetI ASST 4 cut(s) 102, 146, 163, 286
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 3 cut(s) 155, 213, 240
SsiI CCGC 1 cut(s) 123
SspMI CTAG 2 cut(s) 9, 195
StyI CCWWGG 1 cut(s) 90
TaqI TCGA 2 cut(s) 132, 262
TasI AATT 3 cut(s) 155, 213, 240
TatI WGTACW 1 cut(s) 277
Tru1I TTAA 3 cut(s) 27, 38, 352
Tru9I TTAA 3 cut(s) 27, 38, 352
XapI RAATTY 1 cut(s) 213
XspI CTAG 2 cut(s) 9, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.