Rh7DG264400

Blue copper protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0005440
Physical Location & Seq
Forward (+)
28124076 .. 28125645
1570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG264400.1

Sequence Viewer

Length: 780 bp
ATGGAGGAGACGCGAAATAAGGTGCTCATCACCTCAGCATGTTTTCTTATTCTTGTTTCAGTTTCCAGTAATTCTGTTCATGCCTACAAGAACCACACAGTGGGCGACTCCTTGGGTTGGTACGACAACCTCCAAAAGGCTGATCTTAATTACCAGAACTGGGCTGCAGCCAACAACTTCAGCTTGGGAGATTTTCTCATTTTCAATACTGATACGAACCACTCGGTCGTCCAAACCTATAACATGACAACGTACAAGCTGTGCGATTATGACGACGACGAGGAGAAGGATATAATTCAATGGTCGGAAGCGAACCCGTCAAACACCGCCACACACGATGTGTCGGTGGCAGTTGCTTTGTTAAAAGAGGGCATCACATATTTCTTTTCCGGTGATTATGATGGCGAACAGTGCCAGAATGGGCAGCACTTCAAGATAAATGTTACTCACGGACAAGGCTTGCCAAAGAGTTTAGACGATTCCCCGGCAGGACCAGCAAGCAGTCCACAGTCAAGCAATGGAGACGTTGAATCAATCCCGGACACAATCGTCCCTAATTCCAACTTCAATGACCCCAAACAAGAAGATGACAATGATGATAAACAGCCATCTGGATCCGTTTCATTTTCAGTTCGGCCTCATGTACAAGGCAATCTGATTTTCGTTTTGCTAGAACAAATCAGCAAAACTGAAGTTCCAATCTCACAAGAAAAGCAATCAAGTGGGTTTCACTTTACAACAATTAACCATGTAATCATGGAAGTGCATGATAACCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

259

Amino Acids

28.73

Weight (kDa)

4.5

Isoelectric Point (pI)

36.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 47 - 142 6e-14 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 548
AccB7I CCANNNNNTGG 1 cut(s) 100
AccII CGCG 1 cut(s) 13
AciI CCGC 1 cut(s) 327
AclWI GGATC 2 cut(s) 609, 622
AcuI CTGAAG 2 cut(s) 163, 711
AdeI CACNNNGTG 2 cut(s) 100, 340
AfaI GTAC 3 cut(s) 122, 254, 645
AfiI CCNNNNNNNGG 4 cut(s) 100, 117, 136, 160
AgsI TTSAA 5 cut(s) 205, 299, 433, 530, 568
AluBI AGCT 2 cut(s) 183, 259
AluI AGCT 2 cut(s) 183, 259
Alw21I GWGCWC 1 cut(s) 27
Alw26I GTCTC 2 cut(s) 2, 516
AlwI GGATC 2 cut(s) 609, 622
AoxI GGCC 1 cut(s) 635
ApeKI GCWGC 3 cut(s) 164, 167, 424
AspS9I GGNCC 1 cut(s) 491
AsuC2I CCSGG 2 cut(s) 485, 539
AsuHPI GGTGA 2 cut(s) 22, 404
AvaII GGWCC 1 cut(s) 491
BamHI GGATCC 1 cut(s) 614
Bbv12I GWGCWC 1 cut(s) 27
BbvCI CCTCAGC 1 cut(s) 34
BbvI GCAGC 3 cut(s) 151, 179, 436
BccI CCATC 2 cut(s) 395, 616
BcnI CCSGG 2 cut(s) 485, 539
BcoDI GTCTC 2 cut(s) 2, 516
BfaI CTAG 1 cut(s) 671
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 3 cut(s) 165, 168, 425
BlsI GCNGC 3 cut(s) 166, 169, 426
Bme1390I CCNGG 2 cut(s) 485, 539
Bme18I GGWCC 1 cut(s) 491
BmgT120I GGNCC 1 cut(s) 491
BmiI GGNNCC 1 cut(s) 616
BmrFI CCNGG 2 cut(s) 485, 539
BmrI ACTGGG 1 cut(s) 169
BmsI GCATC 1 cut(s) 381
BmuI ACTGGG 1 cut(s) 169
BplI GAGNNNNNCTC 2 cut(s) 180, 212
Bpu10I CCTNAGC 1 cut(s) 34
BpuMI CCSGG 2 cut(s) 485, 539
BsaJI CCNNGG 2 cut(s) 111, 483
BsaWI WCCGGW 1 cut(s) 389
Bsc4I CCNNNNNNNGG 4 cut(s) 100, 117, 136, 160
Bse1I ACTGG 2 cut(s) 66, 164
Bse3DI GCAATG 1 cut(s) 523
BseDI CCNNGG 2 cut(s) 111, 483
BseLI CCNNNNNNNGG 4 cut(s) 100, 117, 136, 160
BseMI GCAATG 1 cut(s) 523
BseMII CTCAG 1 cut(s) 48
BseNI ACTGG 2 cut(s) 66, 164
BseRI GAGGAG 2 cut(s) 20, 296
BseXI GCAGC 3 cut(s) 151, 179, 436
Bsh1236I CGCG 1 cut(s) 13
Bsh1285I CGRYCG 1 cut(s) 228
BshFI GGCC 1 cut(s) 637
BsiEI CGRYCG 1 cut(s) 228
BsiHKAI GWGCWC 1 cut(s) 27
BsiSI CCGG 3 cut(s) 390, 485, 539
BslFI GGGAC 1 cut(s) 536
BslI CCNNNNNNNGG 4 cut(s) 100, 117, 136, 160
BsmAI GTCTC 2 cut(s) 2, 516
BsmBI CGTCTC 2 cut(s) 2, 516
BsmFI GGGAC 1 cut(s) 536
BsnI GGCC 1 cut(s) 637
Bsp1286I GDGCHC 1 cut(s) 27
Bsp1407I TGTACA 1 cut(s) 643
Bsp143I GATC 2 cut(s) 142, 614
BspACI CCGC 1 cut(s) 327
BspANI GGCC 1 cut(s) 637
BspCNI CTCAG 1 cut(s) 47
BspFNI CGCG 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 616
BspMAI CTGCAG 1 cut(s) 169
BspPI GGATC 2 cut(s) 609, 622
BsrDI GCAATG 1 cut(s) 523
BsrGI TGTACA 1 cut(s) 643
BsrI ACTGG 2 cut(s) 66, 164
BssECI CCNNGG 2 cut(s) 111, 483
BssMI GATC 2 cut(s) 142, 614
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 3 cut(s) 100, 411, 510
BstAUI TGTACA 1 cut(s) 643
BstC8I GCNNGC 2 cut(s) 461, 499
BstDEI CTNAG 1 cut(s) 34
BstENI CCTNNNNNAGG 1 cut(s) 134
BstFNI CGCG 1 cut(s) 13
BstKTI GATC 2 cut(s) 145, 617
BstMAI GTCTC 2 cut(s) 2, 516
BstMBI GATC 2 cut(s) 142, 614
BstMCI CGRYCG 1 cut(s) 228
BstMWI GCNNNNNNNGC 2 cut(s) 411, 494
BstNSI RCATGY 1 cut(s) 42
BstSCI CCNGG 2 cut(s) 483, 537
BstSFI CTRYAG 1 cut(s) 165
BstUI CGCG 1 cut(s) 13
BstV1I GCAGC 3 cut(s) 151, 179, 436
BstX2I RGATCY 1 cut(s) 614
BstYI RGATCY 1 cut(s) 614
BsuRI GGCC 1 cut(s) 637
BtsIMutI CAGTG 2 cut(s) 105, 416
Cac8I GCNNGC 2 cut(s) 461, 499
Cfr13I GGNCC 1 cut(s) 491
CseI GACGC 1 cut(s) 19
Csp6I GTAC 3 cut(s) 121, 253, 644
CviAII CATG 7 cut(s) 39, 80, 244, 641, 749, 757, 767
CviJI RGCY 8 cut(s) 140, 164, 170, 183, 259, 459, 607, 637
CviKI_1 RGCY 8 cut(s) 140, 164, 170, 183, 259, 459, 607, 637
CviQI GTAC 3 cut(s) 121, 253, 644
DdeI CTNAG 1 cut(s) 34
DpnI GATC 2 cut(s) 144, 616
DpnII GATC 2 cut(s) 142, 614
DraIII CACNNNGTG 2 cut(s) 100, 340
DrdI GACNNNNNNGTC 1 cut(s) 548
DseDI GACNNNNNNGTC 1 cut(s) 548
Eco130I CCWWGG 1 cut(s) 111
Eco47I GGWCC 1 cut(s) 491
Eco57I CTGAAG 2 cut(s) 163, 711
EcoNI CCTNNNNNAGG 1 cut(s) 134
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
Esp3I CGTCTC 2 cut(s) 2, 516
FaeI CATG 7 cut(s) 42, 83, 247, 644, 752, 760, 770
FaqI GGGAC 1 cut(s) 536
FatI CATG 7 cut(s) 38, 79, 243, 640, 748, 756, 766
Fnu4HI GCNGC 3 cut(s) 165, 168, 425
Fsp4HI GCNGC 3 cut(s) 165, 168, 425
FspBI CTAG 1 cut(s) 671
GluI GCNGC 3 cut(s) 165, 168, 425
HaeIII GGCC 1 cut(s) 637
HapII CCGG 3 cut(s) 390, 485, 539
HgaI GACGC 1 cut(s) 19
Hin1II CATG 7 cut(s) 42, 83, 247, 644, 752, 760, 770
HinfI GANTC 3 cut(s) 107, 479, 530
HpaII CCGG 3 cut(s) 390, 485, 539
HphI GGTGA 2 cut(s) 22, 404
Hpy166II GTNNAC 1 cut(s) 506
Hpy188I TCNGA 2 cut(s) 307, 657
Hpy188III TCNNGA 2 cut(s) 433, 612
Hpy8I GTNNAC 1 cut(s) 506
Hpy99I CGWCG 2 cut(s) 278, 281
HpyAV CCTTC 1 cut(s) 280
HpyCH4III ACNGT 3 cut(s) 100, 411, 510
HpyCH4IV ACGT 2 cut(s) 251, 525
HpyCH4V TGCA 2 cut(s) 167, 766
HpyF10VI GCNNNNNNNGC 2 cut(s) 411, 494
HpyF3I CTNAG 1 cut(s) 34
HpySE526I ACGT 2 cut(s) 251, 525
Hsp92II CATG 7 cut(s) 42, 83, 247, 644, 752, 760, 770
Kzo9I GATC 2 cut(s) 142, 614
Lsp1109I GCAGC 3 cut(s) 151, 179, 436
LweI GCATC 1 cut(s) 381
MaeI CTAG 1 cut(s) 671
MaeII ACGT 2 cut(s) 251, 525
MaeIII GTNAC 1 cut(s) 442
MalI GATC 2 cut(s) 144, 616
MboI GATC 2 cut(s) 142, 614
MboII GAAGA 1 cut(s) 596
MflI RGATCY 1 cut(s) 614
MhlI GDGCHC 1 cut(s) 27
MluCI AATT 5 cut(s) 70, 148, 294, 556, 741
MlyI GAGTC 1 cut(s) 101
MmeI TCCRAC 2 cut(s) 285, 585
MnlI CCTC 5 cut(s) 43, 140, 274, 361, 648
MseI TTAA 3 cut(s) 147, 362, 744
MslI CAYNNNNRTG 1 cut(s) 761
MspI CCGG 3 cut(s) 390, 485, 539
MspR9I CCNGG 2 cut(s) 485, 539
MvnI CGCG 1 cut(s) 13
MwoI GCNNNNNNNGC 2 cut(s) 411, 494
NciI CCSGG 2 cut(s) 485, 539
NdeII GATC 2 cut(s) 142, 614
NlaIII CATG 7 cut(s) 42, 83, 247, 644, 752, 760, 770
NlaIV GGNNCC 1 cut(s) 616
NspI RCATGY 1 cut(s) 42
PfeI GAWTC 2 cut(s) 479, 530
PflMI CCANNNNNTGG 1 cut(s) 100
PfoI TCCNGGA 1 cut(s) 537
PkrI GCNGC 3 cut(s) 166, 169, 426
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
PspN4I GGNNCC 1 cut(s) 616
PspPI GGNCC 1 cut(s) 491
PstI CTGCAG 1 cut(s) 169
PsuI RGATCY 1 cut(s) 614
RsaI GTAC 3 cut(s) 122, 254, 645
RsaNI GTAC 3 cut(s) 121, 253, 644
RseI CAYNNNNRTG 1 cut(s) 761
SaqAI TTAA 3 cut(s) 147, 362, 744
SatI GCNGC 3 cut(s) 165, 168, 425
Sau3AI GATC 2 cut(s) 142, 614
Sau96I GGNCC 1 cut(s) 491
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 2 cut(s) 485, 539
SduI GDGCHC 1 cut(s) 27
SetI ASST 8 cut(s) 24, 35, 132, 185, 239, 254, 261, 528
SfaNI GCATC 1 cut(s) 381
SfcI CTRYAG 1 cut(s) 165
SinI GGWCC 1 cut(s) 491
SmiMI CAYNNNNRTG 1 cut(s) 761
Sse9I AATT 5 cut(s) 70, 148, 294, 556, 741
SsiI CCGC 1 cut(s) 327
SspMI CTAG 1 cut(s) 671
StyD4I CCNGG 2 cut(s) 483, 537
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 3 cut(s) 100, 411, 510
TaiI ACGT 2 cut(s) 254, 528
TaqII GACCGA 1 cut(s) 214
TasI AATT 5 cut(s) 70, 148, 294, 556, 741
TatI WGTACW 1 cut(s) 643
TfiI GAWTC 2 cut(s) 479, 530
Tru1I TTAA 3 cut(s) 147, 362, 744
Tru9I TTAA 3 cut(s) 147, 362, 744
TscAI CASTG 2 cut(s) 105, 416
TseI GCWGC 3 cut(s) 164, 167, 424
TspDTI ATGAA 2 cut(s) 68, 612
TspGWI ACGGA 2 cut(s) 465, 607
TspRI CASTG 2 cut(s) 105, 416
Van91I CCANNNNNTGG 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 491
XagI CCTNNNNNAGG 1 cut(s) 134
XceI RCATGY 1 cut(s) 42
XspI CTAG 1 cut(s) 671
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.