Rh7DG409900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0008161
Physical Location & Seq
Forward (+)
57567492 .. 57568948
1457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG409900.1

Sequence Viewer

Length: 300 bp
ATGAGGAAAACAAAAAACGAAGAACACAAAATGAAGAACAAGAAGAGAATCTGGGTCGGATGTGAAGTGCGAGCAGGAGAACTCTTCGAGGAAGACGATGAGCTGGATCTTGAGAGGGAATTCACACTTGTTGAGACAAAAGAGAGCTTGGTCGATAAAGATTGGGTAAGCGGAGGTCCACCGGCCAACACAAGCCTCCAGACCAATAAAGTTTCGTATAAGTTCAATAAGTTGAAGACACCATTTGCAACAACAAGTCTGGCCACTAAATCTCCAGGTAAAACCATCGTGAAATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.32

Weight (kDa)

9.01

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 171
AclWI GGATC 1 cut(s) 114
AcoI YGGCCR 2 cut(s) 183, 261
AcsI RAATTY 1 cut(s) 119
AgsI TTSAA 2 cut(s) 226, 235
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 2 cut(s) 103, 147
AluI AGCT 2 cut(s) 103, 147
Alw26I GTCTC 1 cut(s) 128
AlwI GGATC 1 cut(s) 114
AoxI GGCC 2 cut(s) 183, 261
ApoI RAATTY 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 176
AvaII GGWCC 1 cut(s) 176
BalI TGGCCA 1 cut(s) 263
BbsI GAAGAC 2 cut(s) 99, 242
BccI CCATC 1 cut(s) 293
BciT130I CCWGG 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 276
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmrFI CCNGG 1 cut(s) 276
BpiI GAAGAC 2 cut(s) 99, 242
BpmI CTGGAG 2 cut(s) 182, 258
BpuEI CTTGAG 1 cut(s) 131
BsaXI ACNNNNNCTCC 2 cut(s) 256, 286
Bse118I RCCGGY 1 cut(s) 181
BseBI CCWGG 1 cut(s) 276
BseGI GGATG 1 cut(s) 65
BshFI GGCC 2 cut(s) 185, 263
BsiSI CCGG 1 cut(s) 182
BsmAI GTCTC 1 cut(s) 128
BsnI GGCC 2 cut(s) 185, 263
Bsp143I GATC 1 cut(s) 106
BspACI CCGC 1 cut(s) 171
BspANI GGCC 2 cut(s) 185, 263
BspPI GGATC 1 cut(s) 114
BsrFI RCCGGY 1 cut(s) 181
BssAI RCCGGY 1 cut(s) 181
BssMI GATC 1 cut(s) 106
Bst2UI CCWGG 1 cut(s) 276
Bst6I CTCTTC 2 cut(s) 38, 89
BstC8I GCNNGC 1 cut(s) 72
BstF5I GGATG 1 cut(s) 65
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 276
BstSCI CCNGG 1 cut(s) 274
BstV2I GAAGAC 2 cut(s) 99, 242
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
BsuRI GGCC 2 cut(s) 185, 263
BtsCI GGATG 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 72
Cfr10I RCCGGY 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 176
CviJI RGCY 5 cut(s) 103, 147, 185, 195, 263
CviKI_1 RGCY 5 cut(s) 103, 147, 185, 195, 263
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 2 cut(s) 183, 261
Eam1104I CTCTTC 2 cut(s) 38, 89
EarI CTCTTC 2 cut(s) 38, 89
Eco47I GGWCC 1 cut(s) 176
EcoRI GAATTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 274
FaiI YATR 2 cut(s) 219, 298
FokI GGATG 1 cut(s) 72
GsuI CTGGAG 2 cut(s) 182, 258
HaeIII GGCC 2 cut(s) 185, 263
HapII CCGG 1 cut(s) 182
HinfI GANTC 1 cut(s) 48
HpaII CCGG 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 179
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 3 cut(s) 110, 199, 289
Hpy8I GTNNAC 1 cut(s) 179
HpyCH4V TGCA 1 cut(s) 248
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 8 cut(s) 37, 60, 89, 195, 212, 245, 261, 288
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 6 cut(s) 32, 46, 55, 76, 104, 247
MflI RGATCY 1 cut(s) 106
MlsI TGGCCA 1 cut(s) 263
MluCI AATT 2 cut(s) 119, 293
MluNI TGGCCA 1 cut(s) 263
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 4 cut(s) 82, 108, 167, 206
Mox20I TGGCCA 1 cut(s) 263
MscI TGGCCA 1 cut(s) 263
Msp20I TGGCCA 1 cut(s) 263
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 276
MvaI CCWGG 1 cut(s) 276
NdeII GATC 1 cut(s) 106
PcsI WCGNNNNNNNCGW 1 cut(s) 93
PfeI GAWTC 1 cut(s) 48
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PspPI GGNCC 1 cut(s) 176
PsuI RGATCY 1 cut(s) 106
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 276
SetI ASST 4 cut(s) 105, 149, 178, 280
SinI GGWCC 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 2 cut(s) 119, 293
SsiI CCGC 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 274
TaqI TCGA 2 cut(s) 87, 153
TasI AATT 2 cut(s) 119, 293
TfiI GAWTC 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 47
VpaK11BI GGWCC 1 cut(s) 176
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.