Rw7G034900

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
51990430 .. 51990978
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G034900.1

Sequence Viewer

Length: 549 bp
ATGTCATCGTTGTGCAAGGAGGGTAGTTTGGGGCAAGCTAGGTTGTTGTTTCAAGAATTGAGAACTGCAAATTATTTGCCTAGTGCTGTCTCATTTAATACCATGATTGACGGAATTCTAAAAGCTGGAGATATTAAATCTGCTAAAGAGTTGCTAGAGGATATGTTCAAATTGGGTTTAAGTCCTGATATAATTACCTTCTCTACATTAGTAAACCGGTTTTCAAAACTTGGGCTCTTGGATGAGGCTAGAATGTGTGTTGAGAAGATGATTGCTTGTGGTGTTGAACCTGATGTCTTTGTATTTGATTCTTTATCAAAGGGCTATAGTTCAAAAGGTGAAACAGAAGAAATTGTTAATTTGCTTCATCAGATGGCAGACAAGGATGTTATTCTTGACAAAGAAATAACTTCTACCATCTTGGCATGCCTCTGTCAAATCTCTGACGATGTTGATGTGATGGAGGTTCTCCCAACTTTTTCCAAAAACACATCAAAAGGAATAAGCATTACCTGCAATGAGCTACTGATCAGAGTCAATAAATCTTAA

Protein Analysis

182

Amino Acids

20.01

Weight (kDa)

4.8

Isoelectric Point (pI)

34.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_long PF17177 11 - 128 8.6e-08 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 16 - 74 2.9e-06 Pentatricopeptide repeat domain
PPR_1 PF12854 25 - 55 3.5e-06 PPR repeat
PPR_2 PF13041 27 - 76 4.1e-14 PPR repeat family
PPR PF01535 30 - 60 5.4e-06 PPR repeat
PPR_1 PF12854 59 - 90 1e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 521
AcsI RAATTY 1 cut(s) 114
AgeI ACCGGT 1 cut(s) 216
AgsI TTSAA 5 cut(s) 53, 169, 225, 287, 333
AluBI AGCT 3 cut(s) 38, 125, 523
AluI AGCT 3 cut(s) 38, 125, 523
Alw26I GTCTC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 114
AsiGI ACCGGT 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 350
BanII GRGCYC 1 cut(s) 237
BccI CCATC 3 cut(s) 367, 425, 454
BclI TGATCA 1 cut(s) 528
BcoDI GTCTC 1 cut(s) 94
BfaI CTAG 4 cut(s) 39, 81, 155, 249
BfmI CTRYAG 1 cut(s) 325
BfuAI ACCTGC 1 cut(s) 521
BpmI CTGGAG 1 cut(s) 147
BsaWI WCCGGW 1 cut(s) 216
Bse118I RCCGGY 1 cut(s) 216
Bse3DI GCAATG 1 cut(s) 523
BseGI GGATG 2 cut(s) 247, 391
BseMI GCAATG 1 cut(s) 523
BshTI ACCGGT 1 cut(s) 216
BsiSI CCGG 1 cut(s) 217
BsmAI GTCTC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 237
Bsp143I GATC 1 cut(s) 528
BspMI ACCTGC 1 cut(s) 521
BsrDI GCAATG 1 cut(s) 523
BsrFI RCCGGY 1 cut(s) 216
BssAI RCCGGY 1 cut(s) 216
BssMI GATC 1 cut(s) 528
BstAPI GCANNNNNTGC 1 cut(s) 513
BstC8I GCNNGC 2 cut(s) 36, 427
BstF5I GGATG 2 cut(s) 247, 391
BstKTI GATC 1 cut(s) 531
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 528
BstMWI GCNNNNNNNGC 1 cut(s) 513
BstNSI RCATGY 1 cut(s) 429
BstSFI CTRYAG 1 cut(s) 325
BtsCI GGATG 2 cut(s) 247, 391
BveI ACCTGC 1 cut(s) 521
Cac8I GCNNGC 2 cut(s) 36, 427
Cfr10I RCCGGY 1 cut(s) 216
CspAI ACCGGT 1 cut(s) 216
CviAII CATG 2 cut(s) 103, 426
CviJI RGCY 6 cut(s) 38, 125, 235, 248, 324, 523
CviKI_1 RGCY 6 cut(s) 38, 125, 235, 248, 324, 523
DpnI GATC 1 cut(s) 530
DpnII GATC 1 cut(s) 528
Eco24I GRGCYC 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 114
EcoT38I GRGCYC 1 cut(s) 237
FaeI CATG 2 cut(s) 106, 429
FaiI YATR 5 cut(s) 104, 164, 191, 327, 427
FatI CATG 2 cut(s) 102, 425
FbaI TGATCA 1 cut(s) 528
FokI GGATG 2 cut(s) 254, 398
FriOI GRGCYC 1 cut(s) 237
FspBI CTAG 4 cut(s) 39, 81, 155, 249
GsuI CTGGAG 1 cut(s) 147
HapII CCGG 1 cut(s) 217
Hin1II CATG 2 cut(s) 106, 429
HinfI GANTC 2 cut(s) 308, 534
HpaII CCGG 1 cut(s) 217
HphI GGTGA 1 cut(s) 350
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 3 cut(s) 372, 445, 533
Hpy188III TCNNGA 3 cut(s) 53, 185, 395
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 208
HpyCH4V TGCA 3 cut(s) 15, 68, 516
HpyF10VI GCNNNNNNNGC 1 cut(s) 513
Hsp92II CATG 2 cut(s) 106, 429
Ksp22I TGATCA 1 cut(s) 528
Kzo9I GATC 1 cut(s) 528
LpnPI CCDG 5 cut(s) 111, 198, 230, 303, 526
MaeI CTAG 4 cut(s) 39, 81, 155, 249
MalI GATC 1 cut(s) 530
MboI GATC 1 cut(s) 528
MboII GAAGA 2 cut(s) 277, 359
MhlI GDGCHC 1 cut(s) 237
MluCI AATT 7 cut(s) 56, 70, 114, 170, 192, 351, 358
MlyI GAGTC 1 cut(s) 543
MnlI CCTC 5 cut(s) 13, 151, 238, 440, 457
MseI TTAA 5 cut(s) 96, 135, 179, 357, 547
MslI CAYNNNNRTG 1 cut(s) 10
MspI CCGG 1 cut(s) 217
MwoI GCNNNNNNNGC 1 cut(s) 513
NdeII GATC 1 cut(s) 528
NlaIII CATG 2 cut(s) 106, 429
NspI RCATGY 1 cut(s) 429
PaeI GCATGC 1 cut(s) 429
PfeI GAWTC 1 cut(s) 308
PinAI ACCGGT 1 cut(s) 216
PleI GAGTC 1 cut(s) 542
PpsI GAGTC 1 cut(s) 542
RseI CAYNNNNRTG 1 cut(s) 10
SaqAI TTAA 5 cut(s) 96, 135, 179, 357, 547
Sau3AI GATC 1 cut(s) 528
SchI GAGTC 1 cut(s) 543
SduI GDGCHC 1 cut(s) 237
SetI ASST 9 cut(s) 40, 44, 127, 200, 292, 340, 468, 515, 525
SfcI CTRYAG 1 cut(s) 325
SmiMI CAYNNNNRTG 1 cut(s) 10
SphI GCATGC 1 cut(s) 429
Sse9I AATT 7 cut(s) 56, 70, 114, 170, 192, 351, 358
SspMI CTAG 4 cut(s) 39, 81, 155, 249
TasI AATT 7 cut(s) 56, 70, 114, 170, 192, 351, 358
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 5 cut(s) 96, 135, 179, 357, 547
Tru9I TTAA 5 cut(s) 96, 135, 179, 357, 547
TspDTI ATGAA 1 cut(s) 356
TspGWI ACGGA 1 cut(s) 126
XapI RAATTY 1 cut(s) 114
XceI RCATGY 1 cut(s) 429
XspI CTAG 4 cut(s) 39, 81, 155, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.