AT2G13985

B3 domain-containing protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
5874638 .. 5875793
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G13985.1

Sequence Viewer

Length: 333 bp
ATGTGTGGAGAGATGATTCTGATCGAAGAAAAAGGCAGATCATGGACTGTAGACTTGAAACGAAAGAACTCATGTCCAACTACTTACATCAAACGAGGATGGAGAAGTTTCTGTAATGCCAATGGATTTAGAGCTGGAAGTTTCTTTACTTTCAAACTGTTTCAAAGAGGTGGAACTCTAGGTTTACGTTTATTCCATAGAGAGTTAGAAGAAGAAGCTATGCCAATAGAGTGTCTTTCCACAGAACCTGACCGTAACCAAAACGAGAGAAGCTCACAGATATGGAAAGATTCTTCTTCACCATCTCAAAACCGTTTTGTGACAATTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.8

Weight (kDa)

9.1

Isoelectric Point (pI)

74.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B3 PF02362 4 - 66 2.2e-15 B3 DNA binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 51
AgsI TTSAA 3 cut(s) 58, 154, 164
AluBI AGCT 3 cut(s) 134, 218, 273
AluI AGCT 3 cut(s) 134, 218, 273
AlwNI CAGNNNCTG 1 cut(s) 248
AsuHPI GGTGA 1 cut(s) 291
BarI GAAGNNNNNNTAC 2 cut(s) 130, 162
BccI CCATC 2 cut(s) 93, 310
BfaI CTAG 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 48
BplI GAGNNNNNCTC 2 cut(s) 257, 289
BsaBI GATNNNNATC 1 cut(s) 20
Bse8I GATNNNNATC 1 cut(s) 20
BseGI GGATG 1 cut(s) 104
BseJI GATNNNNATC 1 cut(s) 20
Bsp143I GATC 2 cut(s) 21, 38
BssMI GATC 2 cut(s) 21, 38
Bst4CI ACNGT 4 cut(s) 49, 159, 254, 314
BstF5I GGATG 1 cut(s) 104
BstKTI GATC 2 cut(s) 24, 41
BstMBI GATC 2 cut(s) 21, 38
BstSFI CTRYAG 1 cut(s) 48
BtsCI GGATG 1 cut(s) 104
CaiI CAGNNNCTG 1 cut(s) 248
CviAII CATG 2 cut(s) 42, 72
CviJI RGCY 3 cut(s) 134, 218, 273
CviKI_1 RGCY 3 cut(s) 134, 218, 273
DpnI GATC 2 cut(s) 23, 40
DpnII GATC 2 cut(s) 21, 38
FaeI CATG 2 cut(s) 45, 75
FaiI YATR 5 cut(s) 43, 73, 198, 221, 283
FatI CATG 2 cut(s) 41, 71
FblI GTMKAC 1 cut(s) 51
FokI GGATG 1 cut(s) 111
FspBI CTAG 1 cut(s) 179
Hin1II CATG 2 cut(s) 45, 75
HinfI GANTC 2 cut(s) 16, 290
HphI GGTGA 1 cut(s) 291
Hpy166II GTNNAC 2 cut(s) 52, 185
Hpy188I TCNGA 1 cut(s) 21
Hpy8I GTNNAC 2 cut(s) 52, 185
HpyCH4III ACNGT 4 cut(s) 49, 159, 254, 314
HpyCH4IV ACGT 1 cut(s) 187
HpySE526I ACGT 1 cut(s) 187
Hsp92II CATG 2 cut(s) 45, 75
Kzo9I GATC 2 cut(s) 21, 38
LpnPI CCDG 2 cut(s) 120, 261
MaeI CTAG 1 cut(s) 179
MaeII ACGT 1 cut(s) 187
MaeIII GTNAC 2 cut(s) 254, 319
MalI GATC 2 cut(s) 23, 40
MboI GATC 2 cut(s) 21, 38
MboII GAAGA 5 cut(s) 38, 221, 224, 285, 288
MluCI AATT 1 cut(s) 324
MmeI TCCRAC 1 cut(s) 101
MnlI CCTC 2 cut(s) 89, 161
MseI TTAA 1 cut(s) 331
MslI CAYNNNNRTG 1 cut(s) 280
NdeII GATC 2 cut(s) 21, 38
NlaIII CATG 2 cut(s) 45, 75
NmuCI GTSAC 1 cut(s) 319
PfeI GAWTC 2 cut(s) 16, 290
PstNI CAGNNNCTG 1 cut(s) 248
RseI CAYNNNNRTG 1 cut(s) 280
SaqAI TTAA 1 cut(s) 331
Sau3AI GATC 2 cut(s) 21, 38
SetI ASST 7 cut(s) 136, 172, 184, 190, 220, 250, 275
SfcI CTRYAG 1 cut(s) 48
SgeI CNNG 8 cut(s) 54, 67, 84, 107, 147, 191, 260, 277
SmiMI CAYNNNNRTG 1 cut(s) 280
Sse9I AATT 1 cut(s) 324
SspMI CTAG 1 cut(s) 179
TaaI ACNGT 4 cut(s) 49, 159, 254, 314
TaiI ACGT 1 cut(s) 190
TaqI TCGA 1 cut(s) 24
TasI AATT 1 cut(s) 324
TfiI GAWTC 2 cut(s) 16, 290
Tru1I TTAA 1 cut(s) 331
Tru9I TTAA 1 cut(s) 331
TseFI GTSAC 1 cut(s) 319
Tsp45I GTSAC 1 cut(s) 319
XmiI GTMKAC 1 cut(s) 51
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.