AT3G25170

Cell signaling peptide that may regulate plant stress, growth, and development. Mediates a rapid alkalinization of extracellular space by mediating a transient increase in the cytoplasmic Ca(2 ) concentration leading to a calcium-dependent signaling events through a cell surface receptor and a concomitant activation of some intracellular mitogen-activated protein kinases (By similarity)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
9165667 .. 9166820
1154 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G25170.3

Sequence Viewer

Length: 231 bp
ATGAAGGCATGGATGATAATCTTGTTGGTGATTTGTGTCGCTGTGGTGGTGGAGCAATCAGAGGCTCGCAAAGGTCGAAAGTATTTAAATCCAGGCGTGCTTGACCGGTGTCGTGGTCCTAATCCTCCAGCGGGATGTCATCCTCACAATTCCCACCACAAACCTCGCGTCCCTGTTCACAATTATAGTCGTGGTTGTAGTAGAATTACCCGGTGCAGACGAGATGCCTAG

Protein Analysis

76

Amino Acids

8.61

Weight (kDa)

10.31

Isoelectric Point (pI)

54.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 10 - 74 1.4e-17 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 168
AciI CCGC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 131
AgeI ACCGGT 1 cut(s) 105
AjnI CCWGG 1 cut(s) 91
ArsI GACNNNNNNTTYG 2 cut(s) 153, 185
AsiGI ACCGGT 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 116
AsuC2I CCSGG 1 cut(s) 211
AsuHPI GGTGA 1 cut(s) 40
AvaII GGWCC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 93
BcnI CCSGG 1 cut(s) 211
BfaI CTAG 1 cut(s) 229
Bme1390I CCNGG 2 cut(s) 93, 211
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmrFI CCNGG 2 cut(s) 93, 211
BmsI GCATC 1 cut(s) 214
BoxI GACNNNNGTC 1 cut(s) 108
BpmI CTGGAG 1 cut(s) 111
BpuMI CCSGG 1 cut(s) 211
BsaBI GATNNNNATC 1 cut(s) 17
BsaWI WCCGGW 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse118I RCCGGY 1 cut(s) 105
Bse8I GATNNNNATC 1 cut(s) 17
BseBI CCWGG 1 cut(s) 93
BseGI GGATG 3 cut(s) 18, 139, 140
BseJI GATNNNNATC 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 131
Bsh1236I CGCG 1 cut(s) 168
BshTI ACCGGT 1 cut(s) 105
BsiSI CCGG 2 cut(s) 106, 211
BslFI GGGAC 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 155
BspACI CCGC 1 cut(s) 131
BspFNI CGCG 1 cut(s) 168
BsrFI RCCGGY 1 cut(s) 105
BssAI RCCGGY 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 93
BstC8I GCNNGC 2 cut(s) 67, 98
BstF5I GGATG 3 cut(s) 18, 139, 140
BstFNI CGCG 1 cut(s) 168
BstNI CCWGG 1 cut(s) 93
BstPAI GACNNNNGTC 1 cut(s) 108
BstSCI CCNGG 2 cut(s) 91, 209
BstUI CGCG 1 cut(s) 168
BtsCI GGATG 3 cut(s) 18, 139, 140
Cac8I GCNNGC 2 cut(s) 67, 98
Cfr10I RCCGGY 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 116
CseI GACGC 1 cut(s) 157
CspAI ACCGGT 1 cut(s) 105
CviAII CATG 1 cut(s) 9
CviJI RGCY 1 cut(s) 65
CviKI_1 RGCY 1 cut(s) 65
DraI TTTAAA 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 91
FaeI CATG 1 cut(s) 12
FaiI YATR 2 cut(s) 10, 186
FaqI GGGAC 1 cut(s) 155
FatI CATG 1 cut(s) 8
FauI CCCGC 1 cut(s) 124
FokI GGATG 3 cut(s) 25, 126, 147
FspBI CTAG 1 cut(s) 229
GsuI CTGGAG 1 cut(s) 111
HapII CCGG 2 cut(s) 106, 211
HgaI GACGC 1 cut(s) 157
Hin1II CATG 1 cut(s) 12
HpaII CCGG 2 cut(s) 106, 211
HphI GGTGA 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 61
Hpy8I GTNNAC 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 216
Hsp92II CATG 1 cut(s) 12
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 6 cut(s) 78, 105, 119, 141, 186, 224
LweI GCATC 1 cut(s) 214
MaeI CTAG 1 cut(s) 229
MluCI AATT 3 cut(s) 148, 181, 204
MnlI CCTC 4 cut(s) 55, 135, 153, 174
MseI TTAA 1 cut(s) 86
MspA1I CMGCKG 1 cut(s) 131
MspI CCGG 2 cut(s) 106, 211
MspR9I CCNGG 2 cut(s) 93, 211
MvaI CCWGG 1 cut(s) 93
MvnI CGCG 1 cut(s) 168
NciI CCSGG 1 cut(s) 211
NlaIII CATG 1 cut(s) 12
PcsI WCGNNNNNNNCGW 1 cut(s) 73
PinAI ACCGGT 1 cut(s) 105
PshAI GACNNNNGTC 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PspPI GGNCC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 86
Sau96I GGNCC 1 cut(s) 116
ScrFI CCNGG 2 cut(s) 93, 211
SetI ASST 2 cut(s) 76, 166
SfaNI GCATC 1 cut(s) 214
SinI GGWCC 1 cut(s) 116
SmiI ATTTAAAT 1 cut(s) 87
Sse9I AATT 3 cut(s) 148, 181, 204
SsiI CCGC 1 cut(s) 131
SspMI CTAG 1 cut(s) 229
StyD4I CCNGG 2 cut(s) 91, 209
SwaI ATTTAAAT 1 cut(s) 87
TaqI TCGA 1 cut(s) 76
TasI AATT 3 cut(s) 148, 181, 204
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 116
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.