AT4G13075

Cell signaling peptide that may regulate plant stress, growth, and development. Mediates a rapid alkalinization of extracellular space by mediating a transient increase in the cytoplasmic Ca(2 ) concentration leading to a calcium-dependent signaling events through a cell surface receptor and a concomitant activation of some intracellular mitogen-activated protein kinases (By similarity)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0006497
Physical Location & Seq
Reverse (-)
7624629 .. 7625261
633 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G13075.1

Sequence Viewer

Length: 231 bp
ATGAAGGCTTGGGTCATATGTTTGATGGTAATAAGCATTTTCATGATGATTGAGCCAACACTAGCTGCTGGTGGGGGTAAATTTTTAAATCCAGGAGTGCTTGATCCGTGTTTGCGTCCTAATCCTCCACCAGAGTGTCAAGCCCCAGGATCAGCTGGGAAACCTAGAGAGCGAGTTAATGAATATAAAGTTGGATGCTCCAAACTTACCCGGTGCGACCGTGTCGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.22

Weight (kDa)

8.99

Isoelectric Point (pI)

35.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 10 - 74 2.1e-12 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 98, 157
AcsI RAATTY 1 cut(s) 80
AjnI CCWGG 2 cut(s) 91, 145
AjuI GAANNNNNNNTTGG 2 cut(s) 174, 206
AleI CACNNNNGTG 1 cut(s) 133
AluBI AGCT 2 cut(s) 65, 155
AluI AGCT 2 cut(s) 65, 155
AlwI GGATC 2 cut(s) 98, 157
ApeKI GCWGC 1 cut(s) 65
ApoI RAATTY 1 cut(s) 80
AsuC2I CCSGG 1 cut(s) 211
BbvI GCAGC 1 cut(s) 52
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 2 cut(s) 93, 147
BcnI CCSGG 1 cut(s) 211
BfaI CTAG 2 cut(s) 62, 165
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 3 cut(s) 93, 147, 211
BmrFI CCNGG 3 cut(s) 93, 147, 211
BmsI GCATC 1 cut(s) 185
BpuMI CCSGG 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 145
BseBI CCWGG 2 cut(s) 93, 147
BseDI CCNNGG 1 cut(s) 145
BseGI GGATG 1 cut(s) 200
BseXI GCAGC 1 cut(s) 52
BseYI CCCAGC 1 cut(s) 155
Bsh1285I CGRYCG 1 cut(s) 220
BsiEI CGRYCG 1 cut(s) 220
BsiSI CCGG 1 cut(s) 211
Bsp143I GATC 2 cut(s) 103, 149
BspHI TCATGA 1 cut(s) 42
BspPI GGATC 2 cut(s) 98, 157
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 2 cut(s) 103, 149
Bst2UI CCWGG 2 cut(s) 93, 147
Bst4CI ACNGT 1 cut(s) 221
BstF5I GGATG 1 cut(s) 200
BstKTI GATC 2 cut(s) 106, 152
BstMBI GATC 2 cut(s) 103, 149
BstMCI CGRYCG 1 cut(s) 220
BstNI CCWGG 2 cut(s) 93, 147
BstSCI CCNGG 3 cut(s) 91, 145, 209
BstV1I GCAGC 1 cut(s) 52
BtsCI GGATG 1 cut(s) 200
CciI TCATGA 1 cut(s) 42
CseI GACGC 1 cut(s) 104
CviAII CATG 1 cut(s) 43
CviJI RGCY 5 cut(s) 8, 55, 65, 143, 155
CviKI_1 RGCY 5 cut(s) 8, 55, 65, 143, 155
DpnI GATC 2 cut(s) 105, 151
DpnII GATC 2 cut(s) 103, 149
DraI TTTAAA 1 cut(s) 87
EcoRII CCWGG 2 cut(s) 91, 145
FaeI CATG 1 cut(s) 46
FaiI YATR 4 cut(s) 17, 19, 44, 186
FatI CATG 1 cut(s) 42
FauNDI CATATG 1 cut(s) 17
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 207
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 2 cut(s) 62, 165
GluI GCNGC 1 cut(s) 66
GsaI CCCAGC 1 cut(s) 159
HapII CCGG 1 cut(s) 211
HgaI GACGC 1 cut(s) 104
Hin1II CATG 1 cut(s) 46
HpaII CCGG 1 cut(s) 211
Hpy188I TCNGA 1 cut(s) 227
Hpy188III TCNNGA 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 221
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 2 cut(s) 103, 149
LmnI GCTCC 1 cut(s) 203
LpnPI CCDG 8 cut(s) 54, 78, 105, 132, 141, 144, 159, 224
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 185
MaeI CTAG 2 cut(s) 62, 165
MalI GATC 2 cut(s) 105, 151
MboI GATC 2 cut(s) 103, 149
MluCI AATT 1 cut(s) 80
MmeI TCCRAC 2 cut(s) 172, 205
MnlI CCTC 1 cut(s) 135
MseI TTAA 2 cut(s) 86, 177
MslI CAYNNNNRTG 2 cut(s) 41, 133
MspA1I CMGCKG 1 cut(s) 155
MspI CCGG 1 cut(s) 211
MspR9I CCNGG 3 cut(s) 93, 147, 211
MvaI CCWGG 2 cut(s) 93, 147
NciI CCSGG 1 cut(s) 211
NdeI CATATG 1 cut(s) 17
NdeII GATC 2 cut(s) 103, 149
NlaIII CATG 1 cut(s) 46
OliI CACNNNNGTG 1 cut(s) 133
PagI TCATGA 1 cut(s) 42
PflFI GACNNNGTC 1 cut(s) 221
PfoI TCCNGGA 1 cut(s) 91
PkrI GCNGC 1 cut(s) 67
Psp6I CCWGG 2 cut(s) 91, 145
PspFI CCCAGC 1 cut(s) 155
PspGI CCWGG 2 cut(s) 91, 145
PsyI GACNNNGTC 1 cut(s) 221
PvuII CAGCTG 1 cut(s) 155
RseI CAYNNNNRTG 2 cut(s) 41, 133
SaqAI TTAA 2 cut(s) 86, 177
SatI GCNGC 1 cut(s) 66
Sau3AI GATC 2 cut(s) 103, 149
ScrFI CCNGG 3 cut(s) 93, 147, 211
SetI ASST 3 cut(s) 67, 157, 166
SfaNI GCATC 1 cut(s) 185
SmiMI CAYNNNNRTG 2 cut(s) 41, 133
Sse9I AATT 1 cut(s) 80
SspMI CTAG 2 cut(s) 62, 165
StyD4I CCNGG 3 cut(s) 91, 145, 209
TaaI ACNGT 1 cut(s) 221
TasI AATT 1 cut(s) 80
Tru1I TTAA 2 cut(s) 86, 177
Tru9I TTAA 2 cut(s) 86, 177
TseI GCWGC 1 cut(s) 65
TspDTI ATGAA 3 cut(s) 17, 31, 195
TspGWI ACGGA 1 cut(s) 96
Tth111I GACNNNGTC 1 cut(s) 221
XapI RAATTY 1 cut(s) 80
XspI CTAG 2 cut(s) 62, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.