Prupe.8G194800_v2.0.a1

Rapid ALkalinization Factor (RALF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0006497
Physical Location & Seq
Reverse (-)
18752142 .. 18752363
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G194800.1

Sequence Viewer

Length: 222 bp
ATGAAGACATTCATCCTCTGTTTCCTCATTGTTAGCATGGTGGCGCTGCACGAAGGAGTGGAAGCTGCGGGGACCCGCATTAACCCTGGAGTTCTTGACCCATGCCTAAAACCAGGAGGGCCACATCCTGGTTGTAGTGGTCCTAGTGGCAGCAACGGTGAACGTAAAACCGCTAACCCCTACGATCGTGGTTGCTCGAAAATTAAGCAGTGTCGTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

74

Amino Acids

7.63

Weight (kDa)

8.99

Isoelectric Point (pI)

11.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 128
AciI CCGC 3 cut(s) 68, 76, 171
AfiI CCNNNNNNNGG 1 cut(s) 128
AjnI CCWGG 3 cut(s) 85, 112, 127
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
AoxI GGCC 1 cut(s) 119
ApeKI GCWGC 3 cut(s) 46, 65, 150
Asp700I GAANNNNTTC 1 cut(s) 8
AspLEI GCGC 1 cut(s) 46
AspS9I GGNCC 3 cut(s) 72, 119, 140
AsuHPI GGTGA 1 cut(s) 170
AvaII GGWCC 2 cut(s) 72, 140
BbsI GAAGAC 1 cut(s) 11
BbvI GCAGC 3 cut(s) 33, 52, 162
BciT130I CCWGG 3 cut(s) 87, 114, 129
BfaI CTAG 1 cut(s) 144
BfoI RGCGCY 1 cut(s) 47
BisI GCNGC 3 cut(s) 47, 66, 151
BlsI GCNGC 3 cut(s) 48, 67, 152
Bme1390I CCNGG 3 cut(s) 87, 114, 129
Bme18I GGWCC 2 cut(s) 72, 140
BmgT120I GGNCC 3 cut(s) 72, 119, 140
BmiI GGNNCC 2 cut(s) 73, 74
BmrFI CCNGG 3 cut(s) 87, 114, 129
BpiI GAAGAC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseBI CCWGG 3 cut(s) 87, 114, 129
BseDI CCNNGG 1 cut(s) 85
BseGI GGATG 2 cut(s) 12, 124
BseLI CCNNNNNNNGG 1 cut(s) 128
BseXI GCAGC 3 cut(s) 33, 52, 162
BsgI GTGCAG 1 cut(s) 32
Bsh1285I CGRYCG 1 cut(s) 187
BshFI GGCC 1 cut(s) 121
BsiEI CGRYCG 1 cut(s) 187
BslFI GGGAC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 85
BsnI GGCC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 184
BspACI CCGC 3 cut(s) 68, 76, 171
BspANI GGCC 1 cut(s) 121
BspLI GGNNCC 2 cut(s) 73, 74
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 1 cut(s) 184
Bst2UI CCWGG 3 cut(s) 87, 114, 129
Bst4CI ACNGT 1 cut(s) 158
BstF5I GGATG 2 cut(s) 12, 124
BstH2I RGCGCY 1 cut(s) 47
BstHHI GCGC 1 cut(s) 46
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstMCI CGRYCG 1 cut(s) 187
BstNI CCWGG 3 cut(s) 87, 114, 129
BstSCI CCNGG 3 cut(s) 85, 112, 127
BstV1I GCAGC 3 cut(s) 33, 52, 162
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 1 cut(s) 121
BtsCI GGATG 2 cut(s) 12, 124
BtsI GCAGTG 1 cut(s) 215
BtsIMutI CAGTG 1 cut(s) 215
CfoI GCGC 1 cut(s) 46
Cfr13I GGNCC 3 cut(s) 72, 119, 140
CviAII CATG 2 cut(s) 37, 102
CviJI RGCY 2 cut(s) 65, 121
CviKI_1 RGCY 2 cut(s) 65, 121
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eco47I GGWCC 2 cut(s) 72, 140
EcoO109I RGGNCCY 1 cut(s) 72
EcoRII CCWGG 3 cut(s) 85, 112, 127
FaeI CATG 2 cut(s) 40, 105
FaiI YATR 2 cut(s) 38, 103
FaqI GGGAC 1 cut(s) 85
FatI CATG 2 cut(s) 36, 101
FauI CCCGC 2 cut(s) 61, 83
Fnu4HI GCNGC 3 cut(s) 47, 66, 151
FokI GGATG 1 cut(s) 111
Fsp4HI GCNGC 3 cut(s) 47, 66, 151
FspBI CTAG 1 cut(s) 144
GlaI GCGC 1 cut(s) 45
GluI GCNGC 3 cut(s) 47, 66, 151
GsuI CTGGAG 1 cut(s) 108
HaeII RGCGCY 1 cut(s) 47
HaeIII GGCC 1 cut(s) 121
HhaI GCGC 1 cut(s) 46
Hin1II CATG 2 cut(s) 40, 105
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 49
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 2 cut(s) 40, 105
HspAI GCGC 1 cut(s) 44
KflI GGGWCCC 1 cut(s) 72
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 6 cut(s) 72, 99, 99, 114, 126, 141
Lsp1109I GCAGC 3 cut(s) 33, 52, 162
MaeI CTAG 1 cut(s) 144
MaeII ACGT 1 cut(s) 163
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 1 cut(s) 16
MluCI AATT 1 cut(s) 201
MnlI CCTC 3 cut(s) 26, 35, 110
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 2 cut(s) 81, 204
MspR9I CCNGG 3 cut(s) 87, 114, 129
MvaI CCWGG 3 cut(s) 87, 114, 129
NdeII GATC 1 cut(s) 184
NlaIII CATG 2 cut(s) 40, 105
NlaIV GGNNCC 2 cut(s) 73, 74
PdmI GAANNNNTTC 1 cut(s) 8
PflMI CCANNNNNTGG 1 cut(s) 128
PkrI GCNGC 3 cut(s) 48, 67, 152
Ple19I CGATCG 1 cut(s) 187
PpuMI RGGWCCY 1 cut(s) 72
Psp5II RGGWCCY 1 cut(s) 72
Psp6I CCWGG 3 cut(s) 85, 112, 127
PspGI CCWGG 3 cut(s) 85, 112, 127
PspN4I GGNNCC 2 cut(s) 73, 74
PspPI GGNCC 3 cut(s) 72, 119, 140
PspPPI RGGWCCY 1 cut(s) 72
PvuI CGATCG 1 cut(s) 187
SaqAI TTAA 2 cut(s) 81, 204
SatI GCNGC 3 cut(s) 47, 66, 151
Sau3AI GATC 1 cut(s) 184
Sau96I GGNCC 3 cut(s) 72, 119, 140
ScrFI CCNGG 3 cut(s) 87, 114, 129
SetI ASST 2 cut(s) 67, 166
SinI GGWCC 2 cut(s) 72, 140
Sse9I AATT 1 cut(s) 201
SsiI CCGC 3 cut(s) 68, 76, 171
SspMI CTAG 1 cut(s) 144
StyD4I CCNGG 3 cut(s) 85, 112, 127
TaaI ACNGT 1 cut(s) 158
TaiI ACGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 197
TasI AATT 1 cut(s) 201
Tru1I TTAA 2 cut(s) 81, 204
Tru9I TTAA 2 cut(s) 81, 204
TscAI CASTG 1 cut(s) 215
TseI GCWGC 3 cut(s) 46, 65, 150
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 215
Van91I CCANNNNNTGG 1 cut(s) 128
VpaK11BI GGWCC 2 cut(s) 72, 140
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.