Rmu_sc0006935.1_g000004

Rapid ALkalinization Factor (RALF)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006935.1
Physical Location & Seq
Reverse (-)
13368 .. 14535
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006935.1_g000004.1.cds

Sequence Viewer

Length: 690 bp
atgaaggctctgcctagtcggagtatggtggttgcagccggatggggatgtagttggtttgggcgtggtgtcgtgcggcatctcttttgcttccacacggtgacggcggctgttcatggagcacgatggtggacggggagacaaggattcaaaggctgggcttctctaattttgatgcgtggtggctatggctggtggagcagtgatcagtgtcgatggtcagttgaccatggatggggacagaggtatgttggtggtcatcaggccctatgtcatagggctgatggctgggtgagtggaggggggtggtggcctggagatgagaagatcagctgggcaattcttggttttctgatgattgctcttaggctggtgtcggagatttggggaaaggagggagagggctgtggctggttcttattcttgattagggttttagacaagatcatggggctatcaaacatgaaatccttgatcgtctgtgtgctcatcattcacatggtggcgttgaaccatggagtcacagcaaataacaaatttattgaccctggagttcttgatccttgccaaagaccaggtggaccgcacccgggttgttatcctaataacaacaacagtgagccaaagcctgcaaatccttatagtcgcggttgctcaaaacttactcgttgtcgatcagatccacagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

229

Amino Acids

25.44

Weight (kDa)

9.42

Isoelectric Point (pI)

26.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 648
AciI CCGC 4 cut(s) 76, 107, 584, 648
AclWI GGATC 2 cut(s) 554, 674
AcsI RAATTY 1 cut(s) 536
AdeI CACNNNGTG 2 cut(s) 100, 502
AfiI CCNNNNNNNGG 2 cut(s) 235, 590
AgsI TTSAA 2 cut(s) 151, 511
AjnI CCWGG 3 cut(s) 313, 547, 574
AleI CACNNNNGTG 1 cut(s) 127
AluBI AGCT 1 cut(s) 333
AluI AGCT 1 cut(s) 333
Alw21I GWGCWC 2 cut(s) 124, 489
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 2 cut(s) 554, 674
Ama87I CYCGRG 1 cut(s) 589
AoxI GGCC 2 cut(s) 264, 311
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 536
AspS9I GGNCC 2 cut(s) 265, 581
AsuC2I CCSGG 2 cut(s) 590, 591
AsuHPI GGTGA 2 cut(s) 112, 304
AvaI CYCGRG 1 cut(s) 589
AvaII GGWCC 1 cut(s) 581
Bbv12I GWGCWC 2 cut(s) 124, 489
BbvI GCAGC 1 cut(s) 47
BccI CCATC 5 cut(s) 36, 120, 210, 228, 278
BceAI ACGGC 1 cut(s) 120
BciT130I CCWGG 3 cut(s) 315, 549, 576
BclI TGATCA 1 cut(s) 205
BcnI CCSGG 2 cut(s) 590, 591
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 1 cut(s) 15
BisI GCNGC 3 cut(s) 36, 77, 108
BlsI GCNGC 3 cut(s) 37, 78, 109
Bme1390I CCNGG 5 cut(s) 315, 549, 576, 590, 591
Bme18I GGWCC 1 cut(s) 581
BmeT110I CYCGRG 1 cut(s) 589
BmgT120I GGNCC 2 cut(s) 265, 581
BmrFI CCNGG 5 cut(s) 315, 549, 576, 590, 591
BmsI GCATC 2 cut(s) 88, 165
BpmI CTGGAG 2 cut(s) 336, 570
BpuMI CCSGG 2 cut(s) 590, 591
BsaJI CCNNGG 4 cut(s) 229, 514, 547, 589
Bsc4I CCNNNNNNNGG 2 cut(s) 235, 590
BseBI CCWGG 3 cut(s) 315, 549, 576
BseDI CCNNGG 4 cut(s) 229, 514, 547, 589
BseGI GGATG 3 cut(s) 47, 53, 239
BseLI CCNNNNNNNGG 2 cut(s) 235, 590
BseXI GCAGC 1 cut(s) 47
BseYI CCCAGC 3 cut(s) 156, 288, 333
Bsh1236I CGCG 1 cut(s) 648
BshFI GGCC 2 cut(s) 266, 313
BsiHKAI GWGCWC 2 cut(s) 124, 489
BsiHKCI CYCGRG 1 cut(s) 589
BsiSI CCGG 2 cut(s) 39, 590
BslFI GGGAC 1 cut(s) 252
BslI CCNNNNNNNGG 2 cut(s) 235, 590
BsmAI GTCTC 1 cut(s) 133
BsmFI GGGAC 1 cut(s) 252
BsnI GGCC 2 cut(s) 266, 313
BsoBI CYCGRG 1 cut(s) 589
Bsp1286I GDGCHC 2 cut(s) 124, 489
Bsp143I GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
Bsp19I CCATGG 2 cut(s) 229, 514
BspACI CCGC 4 cut(s) 76, 107, 584, 648
BspANI GGCC 2 cut(s) 266, 313
BspFNI CGCG 1 cut(s) 648
BspPI GGATC 2 cut(s) 554, 674
BssECI CCNNGG 4 cut(s) 229, 514, 547, 589
BssMI GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
BssT1I CCWWGG 2 cut(s) 229, 514
Bst2UI CCWGG 3 cut(s) 315, 549, 576
Bst4CI ACNGT 3 cut(s) 100, 617, 687
BstC8I GCNNGC 1 cut(s) 630
BstDEI CTNAG 1 cut(s) 365
BstDSI CCRYGG 2 cut(s) 229, 514
BstF5I GGATG 3 cut(s) 47, 53, 239
BstFNI CGCG 1 cut(s) 648
BstKTI GATC 7 cut(s) 208, 330, 447, 477, 562, 677, 682
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
BstMWI GCNNNNNNNGC 1 cut(s) 198
BstNI CCWGG 3 cut(s) 315, 549, 576
BstSCI CCNGG 5 cut(s) 313, 547, 574, 588, 589
BstUI CGCG 1 cut(s) 648
BstV1I GCAGC 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 679
BstYI RGATCY 1 cut(s) 679
BsuRI GGCC 2 cut(s) 266, 313
BtgI CCRYGG 2 cut(s) 229, 514
BtsCI GGATG 3 cut(s) 47, 53, 239
BtsI GCAGTG 1 cut(s) 208
BtsIMutI CAGTG 3 cut(s) 208, 215, 622
Cac8I GCNNGC 1 cut(s) 630
Cfr13I GGNCC 2 cut(s) 265, 581
Cfr9I CCCGGG 1 cut(s) 589
CsiI ACCWGGT 1 cut(s) 574
CviAII CATG 6 cut(s) 116, 230, 448, 463, 499, 515
DdeI CTNAG 1 cut(s) 365
DpnI GATC 7 cut(s) 207, 329, 446, 476, 561, 676, 681
DpnII GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
DraIII CACNNNGTG 2 cut(s) 100, 502
Eco130I CCWWGG 2 cut(s) 229, 514
Eco47I GGWCC 1 cut(s) 581
Eco88I CYCGRG 1 cut(s) 589
EcoO109I RGGNCCY 1 cut(s) 265
EcoRII CCWGG 3 cut(s) 313, 547, 574
EcoT14I CCWWGG 2 cut(s) 229, 514
ErhI CCWWGG 2 cut(s) 229, 514
FaeI CATG 6 cut(s) 119, 233, 451, 466, 502, 518
FaqI GGGAC 1 cut(s) 252
FatI CATG 6 cut(s) 115, 229, 447, 462, 498, 514
FbaI TGATCA 1 cut(s) 205
Fnu4HI GCNGC 3 cut(s) 36, 77, 108
FokI GGATG 3 cut(s) 54, 60, 246
Fsp4HI GCNGC 3 cut(s) 36, 77, 108
FspBI CTAG 1 cut(s) 15
GluI GCNGC 3 cut(s) 36, 77, 108
GsaI CCCAGC 3 cut(s) 160, 292, 337
GsuI CTGGAG 2 cut(s) 336, 570
HaeIII GGCC 2 cut(s) 266, 313
HapII CCGG 2 cut(s) 39, 590
Hin1II CATG 6 cut(s) 119, 233, 451, 466, 502, 518
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 2 cut(s) 147, 519
HpaII CCGG 2 cut(s) 39, 590
HphI GGTGA 2 cut(s) 112, 304
Hpy166II GTNNAC 3 cut(s) 132, 226, 581
Hpy188I TCNGA 4 cut(s) 21, 354, 379, 679
Hpy188III TCNNGA 2 cut(s) 424, 557
Hpy8I GTNNAC 3 cut(s) 132, 226, 581
HpyCH4III ACNGT 3 cut(s) 100, 617, 687
HpyCH4V TGCA 2 cut(s) 35, 632
HpyF10VI GCNNNNNNNGC 1 cut(s) 198
HpyF3I CTNAG 1 cut(s) 365
Hsp92II CATG 6 cut(s) 119, 233, 451, 466, 502, 518
Ksp22I TGATCA 1 cut(s) 205
Kzo9I GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
LmnI GCTCC 2 cut(s) 119, 198
Lsp1109I GCAGC 1 cut(s) 47
LweI GCATC 2 cut(s) 88, 165
MabI ACCWGGT 1 cut(s) 574
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 100, 520
MalI GATC 7 cut(s) 207, 329, 446, 476, 561, 676, 681
MboI GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
MboII GAAGA 1 cut(s) 337
MflI RGATCY 1 cut(s) 679
MhlI GDGCHC 2 cut(s) 124, 489
MluCI AATT 3 cut(s) 168, 339, 536
MlyI GAGTC 1 cut(s) 528
MmeI TCCRAC 1 cut(s) 357
MnlI CCTC 4 cut(s) 237, 293, 388, 394
MslI CAYNNNNRTG 2 cut(s) 127, 497
MspA1I CMGCKG 1 cut(s) 333
MspI CCGG 2 cut(s) 39, 590
MspR9I CCNGG 5 cut(s) 315, 549, 576, 590, 591
MvaI CCWGG 3 cut(s) 315, 549, 576
MvnI CGCG 1 cut(s) 648
MwoI GCNNNNNNNGC 1 cut(s) 198
NciI CCSGG 2 cut(s) 590, 591
NcoI CCATGG 2 cut(s) 229, 514
NdeII GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
NlaIII CATG 6 cut(s) 119, 233, 451, 466, 502, 518
NmuCI GTSAC 2 cut(s) 100, 520
OliI CACNNNNGTG 1 cut(s) 127
PfeI GAWTC 1 cut(s) 147
PkrI GCNGC 3 cut(s) 37, 78, 109
PleI GAGTC 1 cut(s) 527
PpsI GAGTC 1 cut(s) 527
Psp6I CCWGG 3 cut(s) 313, 547, 574
PspFI CCCAGC 3 cut(s) 156, 288, 333
PspGI CCWGG 3 cut(s) 313, 547, 574
PspPI GGNCC 2 cut(s) 265, 581
PsuI RGATCY 1 cut(s) 679
PvuII CAGCTG 1 cut(s) 333
RseI CAYNNNNRTG 2 cut(s) 127, 497
SatI GCNGC 3 cut(s) 36, 77, 108
Sau3AI GATC 7 cut(s) 205, 327, 444, 474, 559, 674, 679
Sau96I GGNCC 2 cut(s) 265, 581
SchI GAGTC 1 cut(s) 528
ScrFI CCNGG 5 cut(s) 315, 549, 576, 590, 591
SduI GDGCHC 2 cut(s) 124, 489
SetI ASST 3 cut(s) 248, 335, 580
SexAI ACCWGGT 1 cut(s) 574
SfaNI GCATC 2 cut(s) 88, 165
SinI GGWCC 1 cut(s) 581
SmaI CCCGGG 1 cut(s) 591
SmiMI CAYNNNNRTG 2 cut(s) 127, 497
Sse9I AATT 3 cut(s) 168, 339, 536
SsiI CCGC 4 cut(s) 76, 107, 584, 648
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 5 cut(s) 313, 547, 574, 588, 589
StyI CCWWGG 2 cut(s) 229, 514
TaaI ACNGT 3 cut(s) 100, 617, 687
TaqI TCGA 2 cut(s) 214, 673
TasI AATT 3 cut(s) 168, 339, 536
TauI GCSGC 2 cut(s) 79, 110
TfiI GAWTC 1 cut(s) 147
TscAI CASTG 3 cut(s) 208, 215, 622
TseFI GTSAC 2 cut(s) 100, 520
TseI GCWGC 1 cut(s) 35
Tsp45I GTSAC 2 cut(s) 100, 520
TspDTI ATGAA 3 cut(s) 17, 104, 479
TspMI CCCGGG 1 cut(s) 589
TspRI CASTG 3 cut(s) 208, 215, 622
VpaK11BI GGWCC 1 cut(s) 581
XapI RAATTY 1 cut(s) 536
XcmI CCANNNNNNNNNTGG 1 cut(s) 575
XmaI CCCGGG 1 cut(s) 589
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.