AT5G46980

invertase inhibitor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0002424
Physical Location & Seq
Reverse (-)
19065311 .. 19066007
697 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G46980.1

Sequence Viewer

Length: 555 bp
ATGAAATTCTTGATTCACCTTGTTGTACTCTTTCTCCACCTCAATGGTTTCATGGCCAATAGAGTGGCGGATTCTCTTATTCAAAAATCTTGCAAGGAAAATACAAGATATGCGGAACCATACATTTACAAATTTTGTATCACATCCATCAAAGAGAATCCAGAGAGCCAAAAAGTAAGAAATATTGATGAATTGACTGTGGTATGTACTAATAGCGCGATATCAAACCTAACAAAAGTGAAAGGAACTGTAGAGAACATTTTGAATGAAAGAAAGTATAAGAATAAGTTGAGTCATACGTTCTTACGGGAGTGCCTCAAGCTTTATTCTGAGGGCTATGAGTTGTTAAACTCAGCTTTGAAATACCTCAAAACACTGGATTACGAGAAATTTATAGGAAATATGGATATGGCAAAAGGTAAACCAAGAGCTTGCGAAATGAAATTCAATGATGACAATCACCAGATATCTCCAGTGAAGAAAGAGAACGATGTTCTCTTCGACATGATCAACATTCCGTATTATTTTTGTTTCAATGCTCATATTAACGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

184

Amino Acids

21.44

Weight (kDa)

8.79

Isoelectric Point (pI)

34.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 25 - 172 3.1e-18 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 218
AciI CCGC 2 cut(s) 68, 113
AcoI YGGCCR 1 cut(s) 54
AcsI RAATTY 4 cut(s) 5, 131, 389, 443
AfaI GTAC 2 cut(s) 27, 208
AgsI TTSAA 5 cut(s) 83, 265, 361, 448, 535
AluBI AGCT 3 cut(s) 322, 356, 431
AluI AGCT 3 cut(s) 322, 356, 431
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 4 cut(s) 5, 131, 389, 443
AspLEI GCGC 1 cut(s) 218
AsuHPI GGTGA 2 cut(s) 8, 452
BalI TGGCCA 1 cut(s) 56
BccI CCATC 1 cut(s) 155
BclI TGATCA 1 cut(s) 507
BfaI CTAG 1 cut(s) 553
BfmI CTRYAG 1 cut(s) 249
BmiI GGNNCC 1 cut(s) 117
BpmI CTGGAG 1 cut(s) 456
BpuEI CTTGAG 1 cut(s) 302
BsaBI GATNNNNATC 1 cut(s) 456
BsaXI ACNNNNNCTCC 2 cut(s) 18, 48
Bse1I ACTGG 2 cut(s) 381, 473
Bse8I GATNNNNATC 1 cut(s) 456
BseGI GGATG 1 cut(s) 143
BseJI GATNNNNATC 1 cut(s) 456
BseMII CTCAG 2 cut(s) 321, 366
BseNI ACTGG 2 cut(s) 381, 473
Bsh1236I CGCG 1 cut(s) 218
BshFI GGCC 1 cut(s) 56
BsnI GGCC 1 cut(s) 56
Bsp143I GATC 1 cut(s) 507
BspACI CCGC 2 cut(s) 68, 113
BspANI GGCC 1 cut(s) 56
BspCNI CTCAG 2 cut(s) 322, 365
BspFNI CGCG 1 cut(s) 218
BspLI GGNNCC 1 cut(s) 117
BsrI ACTGG 2 cut(s) 381, 473
BssMI GATC 1 cut(s) 507
Bst4CI ACNGT 2 cut(s) 199, 250
Bst6I CTCTTC 1 cut(s) 503
BstC8I GCNNGC 1 cut(s) 433
BstDEI CTNAG 2 cut(s) 330, 352
BstF5I GGATG 1 cut(s) 143
BstFNI CGCG 1 cut(s) 218
BstHHI GCGC 1 cut(s) 218
BstKTI GATC 1 cut(s) 510
BstMBI GATC 1 cut(s) 507
BstSFI CTRYAG 1 cut(s) 249
BstUI CGCG 1 cut(s) 218
BstXI CCANNNNNNTGG 2 cut(s) 44, 64
BsuRI GGCC 1 cut(s) 56
BtsCI GGATG 1 cut(s) 143
BtsIMutI CAGTG 2 cut(s) 374, 480
Cac8I GCNNGC 1 cut(s) 433
CfoI GCGC 1 cut(s) 218
Csp6I GTAC 2 cut(s) 26, 207
CviAII CATG 2 cut(s) 52, 505
CviJI RGCY 7 cut(s) 56, 168, 322, 336, 356, 431, 552
CviKI_1 RGCY 7 cut(s) 56, 168, 322, 336, 356, 431, 552
CviQI GTAC 2 cut(s) 26, 207
DdeI CTNAG 2 cut(s) 330, 352
DpnI GATC 1 cut(s) 509
DpnII GATC 1 cut(s) 507
EaeI YGGCCR 1 cut(s) 54
Eam1104I CTCTTC 1 cut(s) 503
EarI CTCTTC 1 cut(s) 503
EciI GGCGGA 1 cut(s) 83
Eco32I GATATC 2 cut(s) 222, 468
EcoRV GATATC 2 cut(s) 222, 468
FaeI CATG 2 cut(s) 55, 508
FatI CATG 2 cut(s) 51, 504
FbaI TGATCA 1 cut(s) 507
FokI GGATG 1 cut(s) 130
FspBI CTAG 1 cut(s) 553
GlaI GCGC 1 cut(s) 217
GsuI CTGGAG 1 cut(s) 456
HaeIII GGCC 1 cut(s) 56
HhaI GCGC 1 cut(s) 218
Hin1II CATG 2 cut(s) 55, 508
Hin6I GCGC 1 cut(s) 216
HinP1I GCGC 1 cut(s) 216
HindIII AAGCTT 1 cut(s) 320
HinfI GANTC 4 cut(s) 13, 71, 157, 292
HphI GGTGA 2 cut(s) 8, 452
Hpy166II GTNNAC 1 cut(s) 422
Hpy188I TCNGA 1 cut(s) 331
Hpy188III TCNNGA 2 cut(s) 10, 161
Hpy8I GTNNAC 1 cut(s) 422
HpyCH4III ACNGT 2 cut(s) 199, 250
HpyCH4IV ACGT 1 cut(s) 299
HpyCH4V TGCA 1 cut(s) 93
HpyF3I CTNAG 2 cut(s) 330, 352
HpySE526I ACGT 1 cut(s) 299
Hsp92II CATG 2 cut(s) 55, 508
HspAI GCGC 1 cut(s) 216
Ksp22I TGATCA 1 cut(s) 507
Kzo9I GATC 1 cut(s) 507
LpnPI CCDG 4 cut(s) 174, 362, 476, 486
MaeI CTAG 1 cut(s) 553
MaeII ACGT 1 cut(s) 299
MalI GATC 1 cut(s) 509
MboI GATC 1 cut(s) 507
MboII GAAGA 2 cut(s) 490, 490
MlsI TGGCCA 1 cut(s) 56
MluCI AATT 5 cut(s) 5, 131, 191, 389, 443
MluNI TGGCCA 1 cut(s) 56
MlyI GAGTC 1 cut(s) 301
MnlI CCTC 4 cut(s) 50, 325, 326, 377
Mox20I TGGCCA 1 cut(s) 56
MscI TGGCCA 1 cut(s) 56
MseI TTAA 2 cut(s) 347, 546
MslI CAYNNNNRTG 1 cut(s) 42
Msp20I TGGCCA 1 cut(s) 56
MvnI CGCG 1 cut(s) 218
NdeII GATC 1 cut(s) 507
NlaIII CATG 2 cut(s) 55, 508
NlaIV GGNNCC 1 cut(s) 117
PfeI GAWTC 3 cut(s) 13, 71, 157
PleI GAGTC 1 cut(s) 300
PpsI GAGTC 1 cut(s) 300
PspN4I GGNNCC 1 cut(s) 117
RsaI GTAC 2 cut(s) 27, 208
RsaNI GTAC 2 cut(s) 26, 207
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 2 cut(s) 347, 546
Sau3AI GATC 1 cut(s) 507
SchI GAGTC 1 cut(s) 301
SetI ASST 9 cut(s) 21, 42, 231, 302, 324, 358, 369, 421, 433
SfcI CTRYAG 1 cut(s) 249
SmiMI CAYNNNNRTG 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
Sse9I AATT 5 cut(s) 5, 131, 191, 389, 443
SsiI CCGC 2 cut(s) 68, 113
SspI AATATT 1 cut(s) 184
SspMI CTAG 1 cut(s) 553
TaaI ACNGT 2 cut(s) 199, 250
TaiI ACGT 1 cut(s) 302
TaqI TCGA 1 cut(s) 501
TasI AATT 5 cut(s) 5, 131, 191, 389, 443
TatI WGTACW 2 cut(s) 25, 206
TfiI GAWTC 3 cut(s) 13, 71, 157
Tru1I TTAA 2 cut(s) 347, 546
Tru9I TTAA 2 cut(s) 347, 546
TscAI CASTG 2 cut(s) 381, 480
TspDTI ATGAA 5 cut(s) 17, 40, 204, 282, 455
TspGWI ACGGA 1 cut(s) 507
TspRI CASTG 2 cut(s) 381, 480
XapI RAATTY 4 cut(s) 5, 131, 389, 443
XspI CTAG 1 cut(s) 553
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.