FvH4_2g12080

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
10550165 .. 10552440
2276 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g12080.t1

Sequence Viewer

Length: 363 bp
ATGGAATCAATGGACATGAGGCTGCTTCTTGAGGCTGCAGTTGGTAATAGCATAGATCAAGAGGTCGGAAGAAATGCTTTGGAATCGGTGGGAAAGTCGACTGTATCTTATTTCAGAATTCCCACCTTTTCCAACAGTGATTGGTTGATAATCAAATATGTGAAATCTTGCCTCACAGGTTTCCATTTCTTTTGGTGGATATTAAGATCGAGTACAACCCAGGTGTTTCAACTGTTGCTATTAAGATTTTACTTTTCTGATGAGTTTCCTCTTTTGCAGCTTCAGTTTAGTTGGTTCACTAAAAGAGTTGGTTGGAAATACAAAGTTGCTAATCAGCAGGCGGTAGAAAATTGTAAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

14.18

Weight (kDa)

9.26

Isoelectric Point (pI)

38.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 98
AciI CCGC 1 cut(s) 341
AcsI RAATTY 1 cut(s) 117
AcuI CTGAAG 1 cut(s) 266
AfaI GTAC 1 cut(s) 214
AgsI TTSAA 1 cut(s) 230
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 1 cut(s) 280
AluI AGCT 1 cut(s) 280
ApeKI GCWGC 3 cut(s) 22, 35, 277
ApoI RAATTY 1 cut(s) 117
BbvI GCAGC 3 cut(s) 9, 22, 289
BciT130I CCWGG 1 cut(s) 221
BfmI CTRYAG 1 cut(s) 36
BisI GCNGC 3 cut(s) 23, 36, 278
BlsI GCNGC 3 cut(s) 24, 37, 279
Bme1390I CCNGG 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 221
BpuEI CTTGAG 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 219
BseBI CCWGG 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 219
BseXI GCAGC 3 cut(s) 9, 22, 289
Bsp143I GATC 2 cut(s) 55, 206
BspACI CCGC 1 cut(s) 341
BspMAI CTGCAG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 219
BssMI GATC 2 cut(s) 55, 206
Bst2UI CCWGG 1 cut(s) 221
Bst4CI ACNGT 3 cut(s) 103, 137, 234
BstC8I GCNNGC 1 cut(s) 339
BstKTI GATC 2 cut(s) 58, 209
BstMBI GATC 2 cut(s) 55, 206
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 3 cut(s) 9, 22, 289
BtsIMutI CAGTG 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 339
Csp6I GTAC 1 cut(s) 213
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 22, 35, 280
CviKI_1 RGCY 3 cut(s) 22, 35, 280
CviQI GTAC 1 cut(s) 213
DpnI GATC 2 cut(s) 57, 208
DpnII GATC 2 cut(s) 55, 206
Eco57I CTGAAG 1 cut(s) 266
EcoRI GAATTC 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 219
FaeI CATG 1 cut(s) 19
FaiI YATR 3 cut(s) 17, 53, 159
FalI AAGNNNNNCTT 2 cut(s) 61, 93
FatI CATG 1 cut(s) 15
FblI GTMKAC 1 cut(s) 98
Fnu4HI GCNGC 3 cut(s) 23, 36, 278
Fsp4HI GCNGC 3 cut(s) 23, 36, 278
GluI GCNGC 3 cut(s) 23, 36, 278
Hin1II CATG 1 cut(s) 19
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
HinfI GANTC 2 cut(s) 5, 83
Hpy166II GTNNAC 2 cut(s) 99, 297
Hpy188I TCNGA 3 cut(s) 68, 116, 259
Hpy188III TCNNGA 2 cut(s) 29, 59
Hpy8I GTNNAC 2 cut(s) 99, 297
HpyCH4III ACNGT 3 cut(s) 103, 137, 234
HpyCH4V TGCA 2 cut(s) 38, 277
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 2 cut(s) 55, 206
LpnPI CCDG 4 cut(s) 162, 206, 233, 323
Lsp1109I GCAGC 3 cut(s) 9, 22, 289
MalI GATC 2 cut(s) 57, 208
MboI GATC 2 cut(s) 55, 206
MboII GAAGA 1 cut(s) 81
MluCI AATT 2 cut(s) 117, 349
MmeI TCCRAC 3 cut(s) 46, 156, 293
MnlI CCTC 6 cut(s) 12, 25, 55, 182, 279, 351
MseI TTAA 2 cut(s) 203, 242
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
NdeII GATC 2 cut(s) 55, 206
NlaIII CATG 1 cut(s) 19
PfeI GAWTC 2 cut(s) 5, 83
PkrI GCNGC 3 cut(s) 24, 37, 279
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PstI CTGCAG 1 cut(s) 40
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
SalI GTCGAC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 203, 242
SatI GCNGC 3 cut(s) 23, 36, 278
Sau3AI GATC 2 cut(s) 55, 206
ScrFI CCNGG 1 cut(s) 221
SetI ASST 6 cut(s) 66, 128, 181, 225, 282, 362
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 9 cut(s) 28, 41, 71, 180, 189, 222, 232, 233, 350
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 2 cut(s) 117, 349
SsiI CCGC 1 cut(s) 341
StyD4I CCNGG 1 cut(s) 219
TaaI ACNGT 3 cut(s) 103, 137, 234
TaqI TCGA 2 cut(s) 98, 209
TasI AATT 2 cut(s) 117, 349
TatI WGTACW 1 cut(s) 212
TfiI GAWTC 2 cut(s) 5, 83
Tru1I TTAA 2 cut(s) 203, 242
Tru9I TTAA 2 cut(s) 203, 242
TscAI CASTG 1 cut(s) 142
TseI GCWGC 3 cut(s) 22, 35, 277
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 117
XmiI GTMKAC 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.