Rh2BG107600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0002689
Physical Location & Seq
Forward (+)
9100901 .. 9101232
332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG107600.1

Sequence Viewer

Length: 225 bp
ATGGGACAAGTTTCTTCATCACGCCCTCAGCCATCGAATGATGGCCAGGAACCATCCCGTGTTCATGCACCCAATGCAGAAAGGCAAAGTACAAATACCTCTCAAGGAGAGAGGAGACAATCAGTGAGTTCTTCAGAAGCTATTTTATCGCAGTCTCACCCACTGGATGAAGATCAGGTTAATTTGCATGATACATTGTTTCGTTTGTTACATGTAAACAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.19

Weight (kDa)

5.68

Isoelectric Point (pI)

81.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 43
AcuI CTGAAG 1 cut(s) 117
AfaI GTAC 1 cut(s) 91
AflIII ACRYGT 1 cut(s) 211
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
Alw26I GTCTC 2 cut(s) 109, 159
AoxI GGCC 1 cut(s) 43
AsuHPI GGTGA 1 cut(s) 149
BalI TGGCCA 1 cut(s) 45
BbvCI CCTCAGC 1 cut(s) 27
BccI CCATC 3 cut(s) 35, 40, 61
BciT130I CCWGG 1 cut(s) 47
BcoDI GTCTC 2 cut(s) 109, 159
Bme1390I CCNGG 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 47
Bpu10I CCTNAGC 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 87
BsaBI GATNNNNATC 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 168
Bse8I GATNNNNATC 1 cut(s) 171
BseBI CCWGG 1 cut(s) 47
BseGI GGATG 2 cut(s) 53, 172
BseJI GATNNNNATC 1 cut(s) 171
BseMII CTCAG 1 cut(s) 41
BseNI ACTGG 1 cut(s) 168
BseRI GAGGAG 1 cut(s) 127
BshFI GGCC 1 cut(s) 45
BslFI GGGAC 1 cut(s) 18
BsmAI GTCTC 2 cut(s) 109, 159
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 172
BspANI GGCC 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 168
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 47
BstAPI GCANNNNNTGC 1 cut(s) 74
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 2 cut(s) 53, 172
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 2 cut(s) 109, 159
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 45
BsuRI GGCC 1 cut(s) 45
BtsCI GGATG 2 cut(s) 53, 172
BtsIMutI CAGTG 2 cut(s) 129, 161
Csp6I GTAC 1 cut(s) 90
CviAII CATG 3 cut(s) 65, 188, 212
CviJI RGCY 3 cut(s) 31, 45, 140
CviKI_1 RGCY 3 cut(s) 31, 45, 140
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EaeI YGGCCR 1 cut(s) 43
Eco57I CTGAAG 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 45
FaeI CATG 3 cut(s) 68, 191, 215
FaiI YATR 3 cut(s) 66, 189, 213
FaqI GGGAC 1 cut(s) 18
FatI CATG 3 cut(s) 64, 187, 211
FokI GGATG 2 cut(s) 40, 179
HaeIII GGCC 1 cut(s) 45
Hin1II CATG 3 cut(s) 68, 191, 215
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 1 cut(s) 136
Hpy8I GTNNAC 1 cut(s) 217
HpyCH4V TGCA 3 cut(s) 68, 77, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 3 cut(s) 68, 191, 215
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 4 cut(s) 32, 59, 149, 161
MaeIII GTNAC 1 cut(s) 207
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 3 cut(s) 6, 123, 182
MfeI CAATTG 1 cut(s) 220
MlsI TGGCCA 1 cut(s) 45
MluCI AATT 2 cut(s) 181, 220
MluNI TGGCCA 1 cut(s) 45
MnlI CCTC 3 cut(s) 36, 105, 109
Mox20I TGGCCA 1 cut(s) 45
MscI TGGCCA 1 cut(s) 45
MseI TTAA 1 cut(s) 180
Msp20I TGGCCA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 47
MunI CAATTG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 1 cut(s) 172
NlaIII CATG 3 cut(s) 68, 191, 215
NlaIV GGNNCC 1 cut(s) 51
NspI RCATGY 1 cut(s) 215
PciI ACATGT 1 cut(s) 211
PscI ACATGT 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 51
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 47
SetI ASST 3 cut(s) 101, 142, 180
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
Sse9I AATT 2 cut(s) 181, 220
StyD4I CCNGG 1 cut(s) 45
TaqI TCGA 1 cut(s) 35
TasI AATT 2 cut(s) 181, 220
TatI WGTACW 1 cut(s) 89
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 2 cut(s) 129, 168
TspDTI ATGAA 3 cut(s) 6, 53, 183
TspRI CASTG 2 cut(s) 129, 168
XceI RCATGY 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.