Rh5BG534800

protease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
84359654 .. 84369358
9705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG534800.1

Sequence Viewer

Length: 198 bp
ATGGAACGACAGACTTCTCCTCCAAAAACCATAAAGGTTGGGAACCAGAAAAGTTCTGGTGCATCGATCGGAAGACTAGAGGAAGCTGAACTCTTTGCTAAGTCTGCACAGAATTCATATAAGCAATTTCAGGACAAGGCAGCTTCTTCCAAATCAATGACTGTCATAGGAAGTGAAAAGACACCAATGCAGCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.05

Weight (kDa)

9.7

Isoelectric Point (pI)

33.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 112
AluBI AGCT 2 cut(s) 86, 143
AluI AGCT 2 cut(s) 86, 143
ApeKI GCWGC 2 cut(s) 140, 190
ApoI RAATTY 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 79
BbvI GCAGC 1 cut(s) 152
BfaI CTAG 1 cut(s) 77
BisI GCNGC 2 cut(s) 141, 191
BlsI GCNGC 2 cut(s) 142, 192
BmiI GGNNCC 1 cut(s) 44
BmsI GCATC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 79
Bsa29I ATCGAT 1 cut(s) 65
BsaXI ACNNNNNCTCC 1 cut(s) 34
BseCI ATCGAT 1 cut(s) 65
BseRI GAGGAG 1 cut(s) 9
BseXI GCAGC 1 cut(s) 152
BsgI GTGCAG 1 cut(s) 90
Bsh1285I CGRYCG 1 cut(s) 69
BshVI ATCGAT 1 cut(s) 65
BsiEI CGRYCG 1 cut(s) 69
Bsp143I GATC 1 cut(s) 66
BspDI ATCGAT 1 cut(s) 65
BspLI GGNNCC 1 cut(s) 44
BssMI GATC 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 99
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstMCI CGRYCG 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstV1I GCAGC 1 cut(s) 152
BstV2I GAAGAC 1 cut(s) 79
Bsu15I ATCGAT 1 cut(s) 65
BsuTUI ATCGAT 1 cut(s) 65
ClaI ATCGAT 1 cut(s) 65
CviJI RGCY 3 cut(s) 86, 143, 193
CviKI_1 RGCY 3 cut(s) 86, 143, 193
DdeI CTNAG 1 cut(s) 99
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 112
FaiI YATR 5 cut(s) 32, 118, 120, 167, 196
Fnu4HI GCNGC 2 cut(s) 141, 191
Fsp4HI GCNGC 2 cut(s) 141, 191
FspBI CTAG 1 cut(s) 77
GluI GCNGC 2 cut(s) 141, 191
Hpy188I TCNGA 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 3 cut(s) 62, 107, 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 99
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 42, 59, 116
Lsp1109I GCAGC 1 cut(s) 152
LweI GCATC 1 cut(s) 71
MaeI CTAG 1 cut(s) 77
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MboII GAAGA 2 cut(s) 84, 138
MluCI AATT 2 cut(s) 112, 125
MnlI CCTC 2 cut(s) 30, 73
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 1 cut(s) 66
NlaIV GGNNCC 1 cut(s) 44
PkrI GCNGC 2 cut(s) 142, 192
Ple19I CGATCG 1 cut(s) 69
PspN4I GGNNCC 1 cut(s) 44
PvuI CGATCG 1 cut(s) 69
SatI GCNGC 2 cut(s) 141, 191
Sau3AI GATC 1 cut(s) 66
SetI ASST 3 cut(s) 39, 88, 145
SfaNI GCATC 1 cut(s) 71
SgeI CNNG 5 cut(s) 58, 69, 89, 143, 148
Sse9I AATT 2 cut(s) 112, 125
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 65
TasI AATT 2 cut(s) 112, 125
TseI GCWGC 2 cut(s) 140, 190
TspDTI ATGAA 1 cut(s) 105
XapI RAATTY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 53
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.