Rh4DG137800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
27441901 .. 27451450
9550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG137800.1

Sequence Viewer

Length: 312 bp
ATGACTTTCTGTTTGGAGTTTTCATGGCTTGGAGTCATCATTTGCAGTTATGCAAATACATTGTACAGAATAATTCCTGAGCTTCCCAACCAGTACAAGATTAAGATTATTATGGGCCAAGTTCCTTCATCACGCTTTCACACACCTGATGAAGACCAGGGACCTAACCGTCTTCAAGCACAAGAGGCAGAAAGGCAAAGTATAAATACTCCCCATGGAGAAACGAGACAATCAATGAGTCCTTCACAATCTCTTTCATCACACTCTTACCCACCCAACGAAGACCAGGTACATTTGAATTCATTTCGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.82

Weight (kDa)

6.03

Isoelectric Point (pI)

57.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 168
AcsI RAATTY 1 cut(s) 298
AfaI GTAC 3 cut(s) 65, 95, 291
AgsI TTSAA 2 cut(s) 176, 298
AjnI CCWGG 2 cut(s) 156, 285
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw26I GTCTC 1 cut(s) 220
AoxI GGCC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 298
ArsI GACNNNNNNTTYG 1 cut(s) 27
AspS9I GGNCC 2 cut(s) 115, 161
AvaII GGWCC 1 cut(s) 161
BarI GAAGNNNNNNTAC 2 cut(s) 273, 305
BbsI GAAGAC 3 cut(s) 159, 164, 288
BciT130I CCWGG 2 cut(s) 158, 287
BcoDI GTCTC 1 cut(s) 220
Bme1390I CCNGG 2 cut(s) 158, 287
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 2 cut(s) 115, 161
BmiI GGNNCC 1 cut(s) 162
BmrFI CCNGG 2 cut(s) 158, 287
BpiI GAAGAC 3 cut(s) 159, 164, 288
Bpu10I CCTNAGC 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 157, 214
Bse1I ACTGG 1 cut(s) 91
BseBI CCWGG 2 cut(s) 158, 287
BseDI CCNNGG 2 cut(s) 157, 214
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 91
BshFI GGCC 1 cut(s) 117
BslFI GGGAC 1 cut(s) 174
BsmAI GTCTC 1 cut(s) 220
BsmFI GGGAC 1 cut(s) 174
BsnI GGCC 1 cut(s) 117
Bsp1407I TGTACA 1 cut(s) 63
Bsp19I CCATGG 1 cut(s) 214
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 162
BsrGI TGTACA 1 cut(s) 63
BsrI ACTGG 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 157, 214
BssT1I CCWWGG 1 cut(s) 214
Bst2UI CCWGG 2 cut(s) 158, 287
Bst4CI ACNGT 1 cut(s) 170
BstAUI TGTACA 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 78
BstDSI CCRYGG 1 cut(s) 214
BstMAI GTCTC 1 cut(s) 220
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNI CCWGG 2 cut(s) 158, 287
BstSCI CCNGG 2 cut(s) 156, 285
BstV2I GAAGAC 3 cut(s) 159, 164, 288
BsuRI GGCC 1 cut(s) 117
BtgI CCRYGG 1 cut(s) 214
Cfr13I GGNCC 2 cut(s) 115, 161
CsiI ACCWGGT 1 cut(s) 285
Csp6I GTAC 3 cut(s) 64, 94, 290
CviAII CATG 2 cut(s) 24, 215
CviJI RGCY 3 cut(s) 28, 82, 117
CviKI_1 RGCY 3 cut(s) 28, 82, 117
CviQI GTAC 3 cut(s) 64, 94, 290
DdeI CTNAG 1 cut(s) 78
DrdI GACNNNNNNGTC 1 cut(s) 168
DseDI GACNNNNNNGTC 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 161
EcoRI GAATTC 1 cut(s) 298
EcoRII CCWGG 2 cut(s) 156, 285
EcoT14I CCWWGG 1 cut(s) 214
ErhI CCWWGG 1 cut(s) 214
FaeI CATG 2 cut(s) 27, 218
FaiI YATR 5 cut(s) 25, 51, 113, 203, 216
FaqI GGGAC 1 cut(s) 174
FatI CATG 2 cut(s) 23, 214
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 2 cut(s) 27, 218
HinfI GANTC 2 cut(s) 33, 238
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 2 cut(s) 135, 252
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4V TGCA 2 cut(s) 45, 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 2 cut(s) 27, 218
LpnPI CCDG 7 cut(s) 90, 104, 143, 159, 170, 272, 299
MabI ACCWGGT 1 cut(s) 285
MboII GAAGA 3 cut(s) 164, 164, 293
MluCI AATT 2 cut(s) 72, 298
MlyI GAGTC 2 cut(s) 42, 247
MnlI CCTC 1 cut(s) 178
MseI TTAA 1 cut(s) 102
MspR9I CCNGG 2 cut(s) 158, 287
MvaI CCWGG 2 cut(s) 158, 287
MwoI GCNNNNNNNGC 1 cut(s) 185
NcoI CCATGG 1 cut(s) 214
NlaIII CATG 2 cut(s) 27, 218
NlaIV GGNNCC 1 cut(s) 162
PleI GAGTC 2 cut(s) 41, 246
PpsI GAGTC 2 cut(s) 41, 246
PpuMI RGGWCCY 1 cut(s) 161
Psp5II RGGWCCY 1 cut(s) 161
Psp6I CCWGG 2 cut(s) 156, 285
PspGI CCWGG 2 cut(s) 156, 285
PspN4I GGNNCC 1 cut(s) 162
PspPI GGNCC 2 cut(s) 115, 161
PspPPI RGGWCCY 1 cut(s) 161
RsaI GTAC 3 cut(s) 65, 95, 291
RsaNI GTAC 3 cut(s) 64, 94, 290
SaqAI TTAA 1 cut(s) 102
Sau96I GGNCC 2 cut(s) 115, 161
SchI GAGTC 2 cut(s) 42, 247
ScrFI CCNGG 2 cut(s) 158, 287
SetI ASST 4 cut(s) 84, 148, 166, 291
SexAI ACCWGGT 1 cut(s) 285
SinI GGWCC 1 cut(s) 161
Sse9I AATT 2 cut(s) 72, 298
StyD4I CCNGG 2 cut(s) 156, 285
StyI CCWWGG 1 cut(s) 214
TaaI ACNGT 1 cut(s) 170
TasI AATT 2 cut(s) 72, 298
TatI WGTACW 2 cut(s) 63, 93
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 5 cut(s) 12, 117, 165, 246, 291
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.