FvH4_5g28372

tRNA N-acetyltransferase activity

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
19533725 .. 19534471
747 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g28372.t1

Sequence Viewer

Length: 237 bp
ATGGAATCAATGGACAGGAGGCTGCTTCTTGAGGCTGCAGTTGGTAATAGCACAGATCAAGAGGCCGGAAGAAATGCTATGGAATCGGTGGGAAAGTCGACTGAATTCCCACCTTTTCCAACATTGATTGGTATCAATCAAATATGTGAAATCTTGCCTCACAGGTTTCCATTTCTTTTGGTGGATAGAGAGATCGAGAACAACCCAGGTGTTTCAACTGTTGCTATTAAGATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

79

Amino Acids

8.64

Weight (kDa)

4.78

Isoelectric Point (pI)

51.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 104
AgsI TTSAA 1 cut(s) 216
AjnI CCWGG 1 cut(s) 205
AoxI GGCC 1 cut(s) 63
ApeKI GCWGC 2 cut(s) 22, 35
ApoI RAATTY 1 cut(s) 104
BbvI GCAGC 2 cut(s) 9, 22
BciT130I CCWGG 1 cut(s) 207
BfmI CTRYAG 1 cut(s) 36
BisI GCNGC 2 cut(s) 23, 36
BlsI GCNGC 2 cut(s) 24, 37
Bme1390I CCNGG 1 cut(s) 207
BmrFI CCNGG 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 205
Bse8I GATNNNNATC 1 cut(s) 131
BseBI CCWGG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 205
BseJI GATNNNNATC 1 cut(s) 131
BseXI GCAGC 2 cut(s) 9, 22
BshFI GGCC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 66
BsnI GGCC 1 cut(s) 65
Bsp143I GATC 2 cut(s) 55, 192
BspANI GGCC 1 cut(s) 65
BspMAI CTGCAG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 205
BssMI GATC 2 cut(s) 55, 192
Bst2UI CCWGG 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 220
BstKTI GATC 2 cut(s) 58, 195
BstMBI GATC 2 cut(s) 55, 192
BstNI CCWGG 1 cut(s) 207
BstSCI CCNGG 1 cut(s) 205
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 2 cut(s) 9, 22
BsuRI GGCC 1 cut(s) 65
CviJI RGCY 3 cut(s) 22, 35, 65
CviKI_1 RGCY 3 cut(s) 22, 35, 65
DpnI GATC 2 cut(s) 57, 194
DpnII GATC 2 cut(s) 55, 192
EcoRI GAATTC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 205
FaiI YATR 2 cut(s) 80, 145
FblI GTMKAC 1 cut(s) 98
Fnu4HI GCNGC 2 cut(s) 23, 36
Fsp4HI GCNGC 2 cut(s) 23, 36
GluI GCNGC 2 cut(s) 23, 36
HaeIII GGCC 1 cut(s) 65
HapII CCGG 1 cut(s) 66
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
HinfI GANTC 2 cut(s) 5, 83
HpaII CCGG 1 cut(s) 66
Hpy166II GTNNAC 1 cut(s) 99
Hpy188III TCNNGA 3 cut(s) 29, 59, 196
Hpy8I GTNNAC 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 38
Kzo9I GATC 2 cut(s) 55, 192
LpnPI CCDG 4 cut(s) 79, 148, 192, 219
Lsp1109I GCAGC 2 cut(s) 9, 22
MalI GATC 2 cut(s) 57, 194
MboI GATC 2 cut(s) 55, 192
MboII GAAGA 1 cut(s) 81
MluCI AATT 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 143
MnlI CCTC 4 cut(s) 12, 25, 55, 168
MseI TTAA 1 cut(s) 228
MspI CCGG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 207
MvaI CCWGG 1 cut(s) 207
NdeII GATC 2 cut(s) 55, 192
PfeI GAWTC 2 cut(s) 5, 83
PkrI GCNGC 2 cut(s) 24, 37
Psp6I CCWGG 1 cut(s) 205
PspGI CCWGG 1 cut(s) 205
PstI CTGCAG 1 cut(s) 40
SalI GTCGAC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 228
SatI GCNGC 2 cut(s) 23, 36
Sau3AI GATC 2 cut(s) 55, 192
ScrFI CCNGG 1 cut(s) 207
SetI ASST 3 cut(s) 115, 167, 211
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 9 cut(s) 28, 41, 71, 78, 166, 175, 208, 218, 219
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 205
TaaI ACNGT 1 cut(s) 220
TaqI TCGA 2 cut(s) 98, 195
TasI AATT 1 cut(s) 104
TfiI GAWTC 2 cut(s) 5, 83
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TseI GCWGC 2 cut(s) 22, 35
XapI RAATTY 1 cut(s) 104
XmiI GTMKAC 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.