Rh7CG030700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
2156824 .. 2158597
1774 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG030700.1

Sequence Viewer

Length: 210 bp
ATGCTACTTTCACAAATTCACCTAGCCAATTGTTATTGGGTACTTTGTCTGCAGAGCGGATTCTCGATCAAACCGGAAACGCAGAGAAAGTATGGAGGAACTCGGTTGACAGTGTTGCTAATTCACTTGAGCTTCAGTTCAATTGGTTCACTAGAAGAGCTGGTAGGTAATAGAAACATCGGAGCAGGTCATTTAAAATCAGAAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.64

Weight (kDa)

8.77

Isoelectric Point (pI)

41.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 176
AccBSI CCGCTC 1 cut(s) 57
AciI CCGC 1 cut(s) 57
AcsI RAATTY 2 cut(s) 15, 204
AcuI CTGAAG 1 cut(s) 118
AfaI GTAC 1 cut(s) 42
AgsI TTSAA 1 cut(s) 141
AluBI AGCT 2 cut(s) 132, 160
AluI AGCT 2 cut(s) 132, 160
ApoI RAATTY 2 cut(s) 15, 204
AsuHPI GGTGA 1 cut(s) 11
BfaI CTAG 2 cut(s) 23, 152
BfmI CTRYAG 1 cut(s) 50
BfuAI ACCTGC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 148
BsaWI WCCGGW 1 cut(s) 73
BsiSI CCGG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 66
BspACI CCGC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 54
BspMI ACCTGC 1 cut(s) 176
BspQI GCTCTTC 1 cut(s) 150
BsrBI CCGCTC 1 cut(s) 57
BssMI GATC 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 150
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 117
BveI ACCTGC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 41
CviJI RGCY 3 cut(s) 26, 132, 160
CviKI_1 RGCY 3 cut(s) 26, 132, 160
CviQI GTAC 1 cut(s) 41
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
DraI TTTAAA 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 118
FaiI YATR 1 cut(s) 93
FspBI CTAG 2 cut(s) 23, 152
HapII CCGG 1 cut(s) 74
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HinfI GANTC 1 cut(s) 60
HpaII CCGG 1 cut(s) 74
HphI GGTGA 1 cut(s) 11
Hpy166II GTNNAC 2 cut(s) 108, 149
Hpy188I TCNGA 2 cut(s) 182, 202
Hpy188III TCNNGA 1 cut(s) 64
Hpy8I GTNNAC 2 cut(s) 108, 149
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 52
Kzo9I GATC 1 cut(s) 66
LguI GCTCTTC 1 cut(s) 150
LmnI GCTCC 1 cut(s) 182
LpnPI CCDG 3 cut(s) 87, 146, 171
MaeI CTAG 2 cut(s) 23, 152
MalI GATC 1 cut(s) 68
MbiI CCGCTC 1 cut(s) 57
MboI GATC 1 cut(s) 66
MboII GAAGA 1 cut(s) 167
MfeI CAATTG 2 cut(s) 28, 141
MluCI AATT 5 cut(s) 15, 28, 120, 141, 204
MnlI CCTC 1 cut(s) 89
MseI TTAA 2 cut(s) 194, 208
MspI CCGG 1 cut(s) 74
MunI CAATTG 2 cut(s) 28, 141
NdeII GATC 1 cut(s) 66
PciSI GCTCTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 60
PstI CTGCAG 1 cut(s) 54
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SapI GCTCTTC 1 cut(s) 150
SaqAI TTAA 2 cut(s) 194, 208
Sau3AI GATC 1 cut(s) 66
SetI ASST 5 cut(s) 24, 134, 162, 169, 190
SfcI CTRYAG 1 cut(s) 50
SgeI CNNG 8 cut(s) 35, 76, 86, 114, 139, 164, 173, 198
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 5 cut(s) 15, 28, 120, 141, 204
SsiI CCGC 1 cut(s) 57
SspMI CTAG 2 cut(s) 23, 152
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 65
TasI AATT 5 cut(s) 15, 28, 120, 141, 204
TfiI GAWTC 1 cut(s) 60
Tru1I TTAA 2 cut(s) 194, 208
Tru9I TTAA 2 cut(s) 194, 208
TscAI CASTG 1 cut(s) 117
TspRI CASTG 1 cut(s) 117
XapI RAATTY 2 cut(s) 15, 204
XspI CTAG 2 cut(s) 23, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.