FvH4_3g08700

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0000985
Physical Location & Seq
Reverse (-)
5080419 .. 5084807
4389 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g08700.t8

Sequence Viewer

Length: 285 bp
ATGGTCTCCTTCGCCGCCAGGTCTATGCTCCGCTCCGCCGCCGCCAGAACCATCCTGGGTTCTCGGGTCGCCTCCGCAGCCCGACCCAAACCCGCCGCCGCACCATTCAGCATCCCCAAGCAAAACAAAAACCCCATCTCTCACGCCCTTTTCAGGTCGCCTGTGGAGTTGAGCTGCTGCGTGGAGACGTTGCTTCCCTACCATACTGCCACAGCCTCTGCATTGCTCACTTCCATGCTCTCCGTTTCGCAACGCTCCTACGGTTGGACCCCTGAAGGGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

9.95

Weight (kDa)

10.52

Isoelectric Point (pI)

62.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 33
AciI CCGC 9 cut(s) 15, 31, 36, 39, 42, 75, 93, 96, 99
AfiI CCNNNNNNNGG 5 cut(s) 153, 264, 276, 277, 278
AjnI CCWGG 2 cut(s) 17, 54
AluBI AGCT 1 cut(s) 174
AluI AGCT 1 cut(s) 174
Alw26I GTCTC 2 cut(s) 10, 179
AlwNI CAGNNNCTG 1 cut(s) 218
Ama87I CYCGRG 1 cut(s) 63
ApeKI GCWGC 3 cut(s) 77, 174, 177
AspS9I GGNCC 1 cut(s) 267
AvaI CYCGRG 1 cut(s) 63
AvaII GGWCC 1 cut(s) 267
BbvI GCAGC 3 cut(s) 89, 161, 164
BccI CCATC 2 cut(s) 59, 143
BciT130I CCWGG 2 cut(s) 19, 56
BcoDI GTCTC 2 cut(s) 10, 179
BisI GCNGC 8 cut(s) 15, 39, 42, 78, 96, 99, 175, 178
BlsI GCNGC 8 cut(s) 16, 40, 43, 79, 97, 100, 176, 179
Bme1390I CCNGG 2 cut(s) 19, 56
Bme18I GGWCC 1 cut(s) 267
BmeT110I CYCGRG 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 267
BmiI GGNNCC 1 cut(s) 269
BmrFI CCNGG 2 cut(s) 19, 56
BmsI GCATC 1 cut(s) 120
BsaI GGTCTC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 55
Bsc4I CCNNNNNNNGG 5 cut(s) 153, 264, 276, 277, 278
Bse3DI GCAATG 1 cut(s) 221
BseBI CCWGG 2 cut(s) 19, 56
BseDI CCNNGG 1 cut(s) 55
BseGI GGATG 2 cut(s) 51, 111
BseLI CCNNNNNNNGG 5 cut(s) 153, 264, 276, 277, 278
BseMI GCAATG 1 cut(s) 221
BseXI GCAGC 3 cut(s) 89, 161, 164
BsiHKCI CYCGRG 1 cut(s) 63
BslI CCNNNNNNNGG 5 cut(s) 153, 264, 276, 277, 278
BsmAI GTCTC 2 cut(s) 10, 179
BsmBI CGTCTC 1 cut(s) 179
Bso31I GGTCTC 1 cut(s) 10
BsoBI CYCGRG 1 cut(s) 63
BspACI CCGC 9 cut(s) 15, 31, 36, 39, 42, 75, 93, 96, 99
BspLI GGNNCC 1 cut(s) 269
BspTNI GGTCTC 1 cut(s) 10
BsrBI CCGCTC 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 221
BssECI CCNNGG 1 cut(s) 55
Bst2UI CCWGG 2 cut(s) 19, 56
Bst4CI ACNGT 1 cut(s) 263
BstF5I GGATG 2 cut(s) 51, 111
BstMAI GTCTC 2 cut(s) 10, 179
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNI CCWGG 2 cut(s) 19, 56
BstSCI CCNGG 2 cut(s) 17, 54
BstV1I GCAGC 3 cut(s) 89, 161, 164
BtsCI GGATG 2 cut(s) 51, 111
CaiI CAGNNNCTG 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 267
CviAII CATG 1 cut(s) 235
CviJI RGCY 3 cut(s) 80, 174, 215
CviKI_1 RGCY 3 cut(s) 80, 174, 215
EciI GGCGGA 1 cut(s) 25
Eco31I GGTCTC 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 267
Eco88I CYCGRG 1 cut(s) 63
EcoRII CCWGG 2 cut(s) 17, 54
Esp3I CGTCTC 1 cut(s) 179
FaeI CATG 1 cut(s) 238
FaiI YATR 3 cut(s) 26, 204, 236
FatI CATG 1 cut(s) 234
FauI CCCGC 1 cut(s) 100
Fnu4HI GCNGC 8 cut(s) 15, 39, 42, 78, 96, 99, 175, 178
FokI GGATG 2 cut(s) 38, 98
Fsp4HI GCNGC 8 cut(s) 15, 39, 42, 78, 96, 99, 175, 178
GluI GCNGC 8 cut(s) 15, 39, 42, 78, 96, 99, 175, 178
Hin1II CATG 1 cut(s) 238
HpyAV CCTTC 2 cut(s) 19, 269
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 188
Hsp92II CATG 1 cut(s) 238
LmnI GCTCC 3 cut(s) 33, 38, 260
LpnPI CCDG 7 cut(s) 4, 31, 41, 58, 68, 139, 174
Lsp1109I GCAGC 3 cut(s) 89, 161, 164
LweI GCATC 1 cut(s) 120
MaeII ACGT 1 cut(s) 188
MbiI CCGCTC 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 2 cut(s) 82, 226
MslI CAYNNNNRTG 1 cut(s) 233
MspR9I CCNGG 2 cut(s) 19, 56
MvaI CCWGG 2 cut(s) 19, 56
MwoI GCNNNNNNNGC 1 cut(s) 77
NlaIII CATG 1 cut(s) 238
NlaIV GGNNCC 1 cut(s) 269
PkrI GCNGC 8 cut(s) 16, 40, 43, 79, 97, 100, 176, 179
Psp6I CCWGG 2 cut(s) 17, 54
PspGI CCWGG 2 cut(s) 17, 54
PspN4I GGNNCC 1 cut(s) 269
PspPI GGNCC 1 cut(s) 267
PstNI CAGNNNCTG 1 cut(s) 218
RseI CAYNNNNRTG 1 cut(s) 233
SatI GCNGC 8 cut(s) 15, 39, 42, 78, 96, 99, 175, 178
Sau96I GGNCC 1 cut(s) 267
ScrFI CCNGG 2 cut(s) 19, 56
SetI ASST 4 cut(s) 23, 158, 176, 191
SfaNI GCATC 1 cut(s) 120
SinI GGWCC 1 cut(s) 267
SmiMI CAYNNNNRTG 1 cut(s) 233
SsiI CCGC 9 cut(s) 15, 31, 36, 39, 42, 75, 93, 96, 99
StyD4I CCNGG 2 cut(s) 17, 54
TaaI ACNGT 1 cut(s) 263
TaiI ACGT 1 cut(s) 191
TauI GCSGC 5 cut(s) 17, 41, 44, 98, 101
TseI GCWGC 3 cut(s) 77, 174, 177
TspGWI ACGGA 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 267
XcmI CCANNNNNNNNNTGG 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.